View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8350_low_20 (Length: 310)
Name: NF8350_low_20
Description: NF8350
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8350_low_20 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 141; Significance: 6e-74; HSPs: 2)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 141; E-Value: 6e-74
Query Start/End: Original strand, 141 - 293
Target Start/End: Complemental strand, 5460860 - 5460708
Alignment:
| Q |
141 |
ctctatattttcttaaaatttggttggatatcggtatctcatagatcaaatttttaaaaaatttgaattcgttttaaatgattagataaggggtaaatac |
240 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||| |||||||||||||||||||||||||||||| |
|
|
| T |
5460860 |
ctctatattttcttaaaatttggttggatatcggtatctcatagatcaaattttttaaaaatttgaatttgttttaaatgattagataaggggtaaatac |
5460761 |
T |
 |
| Q |
241 |
tgaaacaaacttcataagtaccattgcgttaaaaaataaataaaacttgaaac |
293 |
Q |
| |
|
| ||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
5460760 |
tcaaacaaacttcataagtaccattgcgttaaaaaataaataaaacttgaaac |
5460708 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 67; E-Value: 9e-30
Query Start/End: Original strand, 7 - 77
Target Start/End: Complemental strand, 5460994 - 5460924
Alignment:
| Q |
7 |
ttggtgttgcaacctgttggcaatgttattgtagccctttggcctataatctcttttgataactcgaagtc |
77 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||| |
|
|
| T |
5460994 |
ttggtgttgcaacctgttggcaatgttattgtagccctttggcctataatcttttttgataactcgaagtc |
5460924 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7 (Bit Score: 29; Significance: 0.0000004; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 153 - 193
Target Start/End: Original strand, 48267897 - 48267937
Alignment:
| Q |
153 |
ttaaaatttggttggatatcggtatctcatagatcaaattt |
193 |
Q |
| |
|
|||||||||||||| |||||||||||||||| || |||||| |
|
|
| T |
48267897 |
ttaaaatttggttgaatatcggtatctcatacataaaattt |
48267937 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University