View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8350_low_24 (Length: 285)
Name: NF8350_low_24
Description: NF8350
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8350_low_24 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 177; Significance: 2e-95; HSPs: 2)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 177; E-Value: 2e-95
Query Start/End: Original strand, 30 - 231
Target Start/End: Original strand, 38581364 - 38581565
Alignment:
| Q |
30 |
tgtttgttcgaatatatatgtatggagtattgaaactcaccatgtgttgtgagataggaaaagggaatcacatatcacccttacaggtctcctgtatgca |
129 |
Q |
| |
|
|||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
38581364 |
tgtttgttggaatatatatgtatggagtattgaaactcaccatgtgttgtgagataggaaaagggaatcacatatcacccttacaggtctcctgtatgca |
38581463 |
T |
|
| Q |
130 |
aggaatggagnnnnnnntcctcaaaacgtgcttatttgttttctcttgctcttttattttaataacctttcaattttggagggggtgtattttattaatg |
229 |
Q |
| |
|
|||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
38581464 |
aggaatggagccccccctcctcaaaacgtgcttatttgttttctcttgctcttttattttaataacctttcaattttggagggggtgtattttattaatg |
38581563 |
T |
|
| Q |
230 |
ca |
231 |
Q |
| |
|
|| |
|
|
| T |
38581564 |
ca |
38581565 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 39; E-Value: 0.0000000000004
Query Start/End: Original strand, 230 - 268
Target Start/End: Original strand, 38581581 - 38581619
Alignment:
| Q |
230 |
cacgcacagtgccaaaaaattatagggacacaaaaagcc |
268 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
38581581 |
cacgcacagtgccaaaaaattatagggacacaaaaagcc |
38581619 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University