View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8350_low_25 (Length: 277)
Name: NF8350_low_25
Description: NF8350
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8350_low_25 |
 |  |
|
| [»] chr3 (2 HSPs) |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 210; Significance: 1e-115; HSPs: 2)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 210; E-Value: 1e-115
Query Start/End: Original strand, 20 - 277
Target Start/End: Original strand, 43489266 - 43489522
Alignment:
| Q |
20 |
actactatctaacaaagaaaaattaaaatttgcatttctagaaacattatcaccacaaaaaatgtcatgaattgtgaatgaattgcattagctattggaa |
119 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||| |||||||||||||||| |||||||| |
|
|
| T |
43489266 |
actactatctaacaaagaaaaattaaaatttgcatttctagaaaaattatcaccacaaaaaatgtcatgaattgcgaatgaattgcattag-tattggaa |
43489364 |
T |
 |
| Q |
120 |
atataaaatgtaataaaagagcaaatttgtgtttggatcttcagcagcagaaggtccacatgatctaaattcaagaaaattacaccagataaaaatggag |
219 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||| || |||| ||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43489365 |
atataaaatgtaataaaagagcaaatttgtgtttggatcttcagcaggaggaggtgcacatgatctaaattcaagaaaattacaccagataaaaatggac |
43489464 |
T |
 |
| Q |
220 |
gatgtagcaatgacacttcgggcaggcgtatcaatatcagtatcgtgtttggtatcca |
277 |
Q |
| |
|
||||||||| ||||||||||| ||||||||||| ||||| |||||||||||||||||| |
|
|
| T |
43489465 |
gatgtagcattgacacttcggacaggcgtatcagtatcaatatcgtgtttggtatcca |
43489522 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 59; E-Value: 5e-25
Query Start/End: Original strand, 195 - 277
Target Start/End: Original strand, 43489523 - 43489605
Alignment:
| Q |
195 |
aaaattacaccagataaaaatggaggatgtagcaatgacacttcgggcaggcgtatcaatatcagtatcgtgtttggtatcca |
277 |
Q |
| |
|
|||||||||||||||||||||||| ||||||||| |||||||| | ||||||||||| |||||||||||||||||||||||| |
|
|
| T |
43489523 |
aaaattacaccagataaaaatggacgatgtagcatcgacacttcagacaggcgtatcagtatcagtatcgtgtttggtatcca |
43489605 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University