View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8350_low_28 (Length: 257)
Name: NF8350_low_28
Description: NF8350
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8350_low_28 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 49; Significance: 4e-19; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 49; E-Value: 4e-19
Query Start/End: Original strand, 37 - 109
Target Start/End: Complemental strand, 14531136 - 14531064
Alignment:
| Q |
37 |
gagatgaaatttaagcacaatgtctagcactcctgaatttaccaaaaaggcagtgacgttttgctgatcatta |
109 |
Q |
| |
|
||||| || ||||||||||||||||||||||| ||||| ||||||||||||||||| ||||||||||||||| |
|
|
| T |
14531136 |
gagattaattttaagcacaatgtctagcactcgtgaatctaccaaaaaggcagtgatattttgctgatcatta |
14531064 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 176 - 208
Target Start/End: Complemental strand, 14530917 - 14530885
Alignment:
| Q |
176 |
ttgaaagagattttgtgcccaagacaggatata |
208 |
Q |
| |
|
||||||||||||||||||||||||||||||||| |
|
|
| T |
14530917 |
ttgaaagagattttgtgcccaagacaggatata |
14530885 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University