View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8352_high_5 (Length: 208)
Name: NF8352_high_5
Description: NF8352
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8352_high_5 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 174; Significance: 8e-94; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 174; E-Value: 8e-94
Query Start/End: Original strand, 12 - 193
Target Start/End: Original strand, 54474876 - 54475057
Alignment:
| Q |
12 |
gcagagacatacagtgctgacatgaaaaagttccggaaactagcattggaaagtagcacagggagcagtgagtacggtgcaactagtgagtatggactca |
111 |
Q |
| |
|
|||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
54474876 |
gcagggacatacagtgctgacatgaaaaagttccggaaactagcattggaaagtagcacagggagcagtgagtacggtgcaactagtgagtatggactca |
54474975 |
T |
 |
| Q |
112 |
acctttctgcctcgagcagtgatcaatcttctgttgattatactaggaggacggtaactggaaccggaggcggatcaaaatt |
193 |
Q |
| |
|
||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
54474976 |
acctttccgcctcgagcagtgatcaatcttctgttgattatactaggaggacggtaactggaaccggaggcggatcaaaatt |
54475057 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University