View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF8352_low_5 (Length: 208)

Name: NF8352_low_5
Description: NF8352
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF8352_low_5
NF8352_low_5
[»] chr3 (1 HSPs)
chr3 (12-193)||(54474876-54475057)


Alignment Details
Target: chr3 (Bit Score: 174; Significance: 8e-94; HSPs: 1)
Name: chr3
Description:

Target: chr3; HSP #1
Raw Score: 174; E-Value: 8e-94
Query Start/End: Original strand, 12 - 193
Target Start/End: Original strand, 54474876 - 54475057
Alignment:
12 gcagagacatacagtgctgacatgaaaaagttccggaaactagcattggaaagtagcacagggagcagtgagtacggtgcaactagtgagtatggactca 111  Q
    |||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
54474876 gcagggacatacagtgctgacatgaaaaagttccggaaactagcattggaaagtagcacagggagcagtgagtacggtgcaactagtgagtatggactca 54474975  T
112 acctttctgcctcgagcagtgatcaatcttctgttgattatactaggaggacggtaactggaaccggaggcggatcaaaatt 193  Q
    ||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
54474976 acctttccgcctcgagcagtgatcaatcttctgttgattatactaggaggacggtaactggaaccggaggcggatcaaaatt 54475057  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University