View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8353_high_10 (Length: 217)
Name: NF8353_high_10
Description: NF8353
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8353_high_10 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 125; Significance: 1e-64; HSPs: 4)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 125; E-Value: 1e-64
Query Start/End: Original strand, 1 - 133
Target Start/End: Original strand, 9123952 - 9124084
Alignment:
| Q |
1 |
attttaccttttacgcaatagagaactcccaacagaggatcacggcaactcacaatcctaatgtggacggtgcatgcaatagagttgaagggtatcaact |
100 |
Q |
| |
|
|||||||||||||||| |||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
9123952 |
attttaccttttacgccatagagaactcccaaccgaggatcacggcaactcacaatcctaatgtggacggtgcatgcaatagagttgaagggtatcaact |
9124051 |
T |
|
| Q |
101 |
acaaaaacatgggacatacatatatacatacat |
133 |
Q |
| |
|
||||||||||||||||||||||||||||||||| |
|
|
| T |
9124052 |
acaaaaacatgggacatacatatatacatacat |
9124084 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 63; E-Value: 1e-27
Query Start/End: Original strand, 130 - 200
Target Start/End: Original strand, 9124138 - 9124207
Alignment:
| Q |
130 |
acatgagtctcatttttaacatatggaaaatgtcaatgccaattgaatcatcaagagacatacgttacaaa |
200 |
Q |
| |
|
||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||| |
|
|
| T |
9124138 |
acatgagtctcatttttaacatatggaaaatgt-aatgccaattgaatcatcaagagacatacgttacaaa |
9124207 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #3
Raw Score: 52; E-Value: 5e-21
Query Start/End: Original strand, 37 - 96
Target Start/End: Original strand, 183556 - 183615
Alignment:
| Q |
37 |
ggatcacggcaactcacaatcctaatgtggacggtgcatgcaatagagttgaagggtatc |
96 |
Q |
| |
|
|||||| |||||||||||||||||| |||||||||||||||||||||||||||||||||| |
|
|
| T |
183556 |
ggatcaaggcaactcacaatcctaacgtggacggtgcatgcaatagagttgaagggtatc |
183615 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #4
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 147 - 200
Target Start/End: Original strand, 183711 - 183763
Alignment:
| Q |
147 |
aacatatggaaaatgtcaatgccaattgaatcatcaagagacatacgttacaaa |
200 |
Q |
| |
|
||||||||||||||| ||||||||||||||| |||||| |||||||||||||| |
|
|
| T |
183711 |
aacatatggaaaatg-caatgccaattgaattctcaagaaacatacgttacaaa |
183763 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University