View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8353_low_13 (Length: 263)
Name: NF8353_low_13
Description: NF8353
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8353_low_13 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 178; Significance: 4e-96; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 178; E-Value: 4e-96
Query Start/End: Original strand, 16 - 245
Target Start/End: Original strand, 27841616 - 27841834
Alignment:
| Q |
16 |
tgtgctttccccacttgtggttctaattccctctaattccaaatacatagcctagccccctttgctatgaaatgatcgtttgcaaacatttttcaatgga |
115 |
Q |
| |
|
||||||||||| |||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
27841616 |
tgtgctttccc-acttgtggttctaattccctctaattccaaattcatagcctagccccctttgctatgaaatgatcgtttgcaaacatttttcaatgga |
27841714 |
T |
|
| Q |
116 |
cacatgaatttgagatggaatcttaattttactttgaaagtaagtagtctttaactattgtatttcttttctctttatcaaaaagggattttttccaaca |
215 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||| ||||||||||| |
|
|
| T |
27841715 |
cacatgaatttgagatggaatcttaattttactttgaaagtaagtagtctttaactattg---------tctctttatcaaaaaggga-tttttccaaca |
27841804 |
T |
|
| Q |
216 |
atgaaagaaaaaacaaagcaaaattatact |
245 |
Q |
| |
|
|||||||||||||||||||||||||||||| |
|
|
| T |
27841805 |
atgaaagaaaaaacaaagcaaaattatact |
27841834 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University