View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8353_low_14 (Length: 244)
Name: NF8353_low_14
Description: NF8353
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8353_low_14 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 202; Significance: 1e-110; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 202; E-Value: 1e-110
Query Start/End: Original strand, 9 - 226
Target Start/End: Complemental strand, 37554335 - 37554118
Alignment:
| Q |
9 |
tggtgttcccatattatttatcaacttcaacaataaaaataattgttggggccaactttgtcgctaataaaaatagagctcgaacgttcttttcactttg |
108 |
Q |
| |
|
|||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||| |
|
|
| T |
37554335 |
tggtgttcgtatattatttatcaacttcaacaataaaaataattgttggggccaactttgtcgctaataaaaacagagctcgaacgttcttttcactttg |
37554236 |
T |
 |
| Q |
109 |
tccgaacaacattccactaatgatggacgaagatacattgatgaagcttgtcccatcttcgtttgcaaactgcctttgcagacatcattttccccgtacc |
208 |
Q |
| |
|
| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
37554235 |
ttcgaacaacattccactaatgatggacgaagatacattgatgaagcttgtcccatcttcgtttgcaaactgcctttgcagacatcattttccccgtacc |
37554136 |
T |
 |
| Q |
209 |
gggaggtccgatcaatac |
226 |
Q |
| |
|
|||||||||||||||||| |
|
|
| T |
37554135 |
gggaggtccgatcaatac |
37554118 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University