View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8354_high_11 (Length: 233)
Name: NF8354_high_11
Description: NF8354
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8354_high_11 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 198; Significance: 1e-108; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 198; E-Value: 1e-108
Query Start/End: Original strand, 18 - 215
Target Start/End: Complemental strand, 52386024 - 52385827
Alignment:
| Q |
18 |
atgaacgccggggtctcttccatttattgaaccttgcaccatcaatgaattattcatactctgtatgttgctgttcacatatgcctttcccgcttcatct |
117 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
52386024 |
atgaacgccggggtctcttccatttattgaaccttgcaccatcaatgaattattcatactctgtatgttgctgttcacatatgcctttcccgcttcatct |
52385925 |
T |
 |
| Q |
118 |
ttctcttcttcctctttggttcggtgtatgttgtggattgaccccttcttccttgttgattgggaatgggaacctgccacatgcattgttgctcctct |
215 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
52385924 |
ttctcttcttcctctttggttcggtgtatgttgtggattgaccccttcttccttgttgattgggaatgggaacctgccacatgcattgttgctcctct |
52385827 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1 (Bit Score: 35; Significance: 0.00000000008; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 35; E-Value: 0.00000000008
Query Start/End: Original strand, 19 - 101
Target Start/End: Complemental strand, 7087895 - 7087813
Alignment:
| Q |
19 |
tgaacgccggggtctcttccatttattgaaccttgcaccatcaatgaattattcatactctgtatgttgctgttcacatatgc |
101 |
Q |
| |
|
||||| || ||||||||| |||| |||||||| || | ||| | ||||||||| ||||| |||||||||||||| |||||||| |
|
|
| T |
7087895 |
tgaactccagggtctctttcattgattgaaccatgaaacatgagtgaattattgatactttgtatgttgctgttaacatatgc |
7087813 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University