View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF8354_high_8 (Length: 244)

Name: NF8354_high_8
Description: NF8354
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF8354_high_8
NF8354_high_8
[»] chr5 (4 HSPs)
chr5 (1-221)||(12547242-12547466)
chr5 (1-221)||(12531153-12531377)
chr5 (3-132)||(9866903-9867032)
chr5 (20-141)||(9894397-9894515)
[»] chr8 (6 HSPs)
chr8 (1-139)||(43479917-43480055)
chr8 (1-139)||(38799242-38799380)
chr8 (1-139)||(38822137-38822275)
chr8 (24-139)||(25865447-25865562)
chr8 (20-139)||(26591915-26592034)
chr8 (27-139)||(41943691-41943803)
[»] scaffold0197 (1 HSPs)
scaffold0197 (3-139)||(30759-30895)
[»] chr7 (2 HSPs)
chr7 (3-139)||(21317321-21317457)
chr7 (3-139)||(3930206-3930342)
[»] chr2 (2 HSPs)
chr2 (3-139)||(13576095-13576231)
chr2 (84-139)||(34571802-34571857)
[»] chr4 (2 HSPs)
chr4 (3-139)||(24860293-24860429)
chr4 (27-139)||(34748502-34748614)
[»] chr1 (1 HSPs)
chr1 (69-141)||(7594907-7594979)


Alignment Details
Target: chr5 (Bit Score: 184; Significance: 1e-99; HSPs: 4)
Name: chr5
Description:

Target: chr5; HSP #1
Raw Score: 184; E-Value: 1e-99
Query Start/End: Original strand, 1 - 221
Target Start/End: Original strand, 12547242 - 12547466
Alignment:
1 cagttccaggacggaatctgtgtggcttcttgactcctccggttgccggagcagatttccgggcagctttggtggcaagctgtttccttggtgcttttcc 100  Q
    ||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||| |||||||||||||||||    
12547242 cagttcctggacggaatctgtgtggcttcttgactcctccggttgccggagcagatttccgggcagctttagtggcaagctgcttccttggtgcttttcc 12547341  T
101 gccggtggatttgcgagctgtttgcttggtacgagccatggcgaattgaggattgaaattagagagagaaagagaaattaaggtttgtttgtt----ttg 196  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||  ||||||||||||||||||||||||||||| ||||||||||||    |||    
12547342 gccggtggatttgcgagctgtttgcttggtacgagccatggcgaattgataattgaaattagagagagaaagagaaattagggtttgtttgtttgtgttg 12547441  T
197 atttcaatttgaatttgcgttgaga 221  Q
    |||||||||||||||||||||||||    
12547442 atttcaatttgaatttgcgttgaga 12547466  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #2
Raw Score: 180; E-Value: 3e-97
Query Start/End: Original strand, 1 - 221
Target Start/End: Complemental strand, 12531377 - 12531153
Alignment:
1 cagttccaggacggaatctgtgtggcttcttgactcctccggttgccggagcagatttccgggcagctttggtggcaagctgtttccttggtgcttttcc 100  Q
    ||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||| |||||||||||||||||    
12531377 cagttcctggacggaatctgtgtggcttcttgactcctccggttgccggagcagatttccgggcagctttagtggcaagctgcttccttggtgcttttcc 12531278  T
101 gccggtggatttgcgagctgtttgcttggtacgagccatggcgaattgaggattgaaattagagagagaaagagaaattaag----gtttgtttgttttg 196  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||  ||||||||||||||||||||||||||||| |    |||||||||| |||    
12531277 gccggtggatttgcgagctgtttgcttggtacgagccatggcgaattgataattgaaattagagagagaaagagaaattagggtctgtttgtttgtgttg 12531178  T
197 atttcaatttgaatttgcgttgaga 221  Q
    |||||||||||||||||||||||||    
12531177 atttcaatttgaatttgcgttgaga 12531153  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #3
Raw Score: 70; E-Value: 1e-31
Query Start/End: Original strand, 3 - 132
Target Start/End: Original strand, 9866903 - 9867032
Alignment:
3 gttccaggacggaatctgtgtggcttcttgactcctccggttgccggagcagatttccgggcagctttggtggcaagctgtttccttggtgcttttccgc 102  Q
    |||||||||||||| | |||||||||||| |||||||| ||||||||||| |||||||| |||||||| ||||| ||||  || | ||||||||| ||||    
9866903 gttccaggacggaaacggtgtggcttcttcactcctcccgttgccggagctgatttccgagcagcttttgtggccagcttctttcatggtgctttaccgc 9867002  T
103 cggtggatttgcgagctgtttgcttggtac 132  Q
    |||||||||||||||| ||||| |||||||    
9867003 cggtggatttgcgagccgtttgtttggtac 9867032  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #4
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 20 - 141
Target Start/End: Complemental strand, 9894515 - 9894397
Alignment:
20 gtgtggcttcttgactcctccggttgccggagcagatttccgggcagctttggtggcaagctgtttccttggtgcttttccgccggtggatttgcgagct 119  Q
    |||||||||||| |||  ||||| |||| |||| ||||| || || ||||||||||||||||| || | ||||||||| ||||| ||    ||||| |||    
9894515 gtgtggcttcttcactgttccggctgccagagctgattttcgagcggctttggtggcaagctgctttcgtggtgctttgccgccagt---attgcgtgct 9894419  T
120 gtttgcttggtacgagccatgg 141  Q
    |||||||||||||  |||||||    
9894418 gtttgcttggtacctgccatgg 9894397  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8 (Bit Score: 91; Significance: 3e-44; HSPs: 6)
Name: chr8
Description:

Target: chr8; HSP #1
Raw Score: 91; E-Value: 3e-44
Query Start/End: Original strand, 1 - 139
Target Start/End: Original strand, 43479917 - 43480055
Alignment:
1 cagttccaggacggaatctgtgtggcttcttgactcctccggttgccggagcagatttccgggcagctttggtggcaagctgtttccttggtgcttttcc 100  Q
    ||||||||||||||||||||||||||||||| ||||||||||| |||||||| |||||||| || ||||||||||| || ||||||||||| ||||| ||    
43479917 cagttccaggacggaatctgtgtggcttcttcactcctccggtggccggagctgatttccgagcggctttggtggcgagttgtttccttggagctttgcc 43480016  T
101 gccggtggatttgcgagctgtttgcttggtacgagccat 139  Q
     ||||||||||||||||| ||||| ||||||||||||||    
43480017 accggtggatttgcgagcggtttgtttggtacgagccat 43480055  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #2
Raw Score: 71; E-Value: 3e-32
Query Start/End: Original strand, 1 - 139
Target Start/End: Complemental strand, 38799380 - 38799242
Alignment:
1 cagttccaggacggaatctgtgtggcttcttgactcctccggttgccggagcagatttccgggcagctttggtggcaagctgtttccttggtgcttttcc 100  Q
    |||||||||| | |||||| ||||||||||| ||||||||||| |||||||| |||||||| || || |||||||| ||||| ||||  || || || ||    
38799380 cagttccaggtctgaatctatgtggcttcttcactcctccggtcgccggagctgatttccgagcggccttggtggcgagctgcttccggggagccttgcc 38799281  T
101 gccggtggatttgcgagctgtttgcttggtacgagccat 139  Q
    ||||||||||||||||||||||||||||||||| |||||    
38799280 gccggtggatttgcgagctgtttgcttggtacgtgccat 38799242  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #3
Raw Score: 71; E-Value: 3e-32
Query Start/End: Original strand, 1 - 139
Target Start/End: Original strand, 38822137 - 38822275
Alignment:
1 cagttccaggacggaatctgtgtggcttcttgactcctccggttgccggagcagatttccgggcagctttggtggcaagctgtttccttggtgcttttcc 100  Q
    |||||||||| | |||||| ||||||||||| ||||||||||| |||||||| |||||||| || || |||||||| ||||| ||||  || || || ||    
38822137 cagttccaggtctgaatctatgtggcttcttcactcctccggtcgccggagctgatttccgagcggccttggtggcgagctgcttccggggagccttgcc 38822236  T
101 gccggtggatttgcgagctgtttgcttggtacgagccat 139  Q
    ||||||||||||||||||||||||||||||||| |||||    
38822237 gccggtggatttgcgagctgtttgcttggtacgtgccat 38822275  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #4
Raw Score: 56; E-Value: 3e-23
Query Start/End: Original strand, 24 - 139
Target Start/End: Complemental strand, 25865562 - 25865447
Alignment:
24 ggcttcttgactcctccggttgccggagcagatttccgggcagctttggtggcaagctgtttccttggtgcttttccgccggtggatttgcgagctgttt 123  Q
    |||||||| ||||| ||||| |  |||||||||||||  ||||||||||| || || || ||||||||||| || |||||||||||||||||||| ||||    
25865562 ggcttcttcactccgccggtggttggagcagatttccttgcagctttggtcgcgagttgcttccttggtgccttgccgccggtggatttgcgagcagttt 25865463  T
124 gcttggtacgagccat 139  Q
    |||| |||||||||||    
25865462 gcttcgtacgagccat 25865447  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #5
Raw Score: 56; E-Value: 3e-23
Query Start/End: Original strand, 20 - 139
Target Start/End: Complemental strand, 26592034 - 26591915
Alignment:
20 gtgtggcttcttgactcctccggttgccggagcagatttccgggcagctttggtggcaagctgtttccttggtgcttttccgccggtggatttgcgagct 119  Q
    |||||||||||| ||||| ||||| |||||||| |||||||| || ||||| || || ||||| |||||||||||||| ||||||||||| ||||| ||     
26592034 gtgtggcttcttcactccgccggtcgccggagcggatttccgagcggcttttgttgcgagctgcttccttggtgctttgccgccggtggacttgcgtgca 26591935  T
120 gtttgcttggtacgagccat 139  Q
    |||||||| ||||| |||||    
26591934 gtttgcttagtacgtgccat 26591915  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #6
Raw Score: 53; E-Value: 2e-21
Query Start/End: Original strand, 27 - 139
Target Start/End: Complemental strand, 41943803 - 41943691
Alignment:
27 ttcttgactcctccggttgccggagcagatttccgggcagctttggtggcaagctgtttccttggtgcttttccgccggtggatttgcgagctgtttgct 126  Q
    ||||||||||| |||||||  ||||||||||| || ||||| |||||||| || || |||||||| || || || ||||||||||||||||| |||||||    
41943803 ttcttgactccaccggttgtaggagcagatttgcgagcagccttggtggccagttgcttccttggagccttgccaccggtggatttgcgagcagtttgct 41943704  T
127 tggtacgagccat 139  Q
    | |||||||||||    
41943703 tagtacgagccat 41943691  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0197 (Bit Score: 73; Significance: 2e-33; HSPs: 1)
Name: scaffold0197
Description:

Target: scaffold0197; HSP #1
Raw Score: 73; E-Value: 2e-33
Query Start/End: Original strand, 3 - 139
Target Start/End: Complemental strand, 30895 - 30759
Alignment:
3 gttccaggacggaatctgtgtggcttcttgactcctccggttgccggagcagatttccgggcagctttggtggcaagctgtttccttggtgcttttccgc 102  Q
    ||||| |||||||| | |||||||||||| ||||||||||| |||||||| |||||||| || ||||||||||| || ||||| | ||| ||||||||||    
30895 gttccgggacggaaacggtgtggcttcttcactcctccggtcgccggagctgatttccgtgcggctttggtggcgagttgtttgcgtggggcttttccgc 30796  T
103 cggtggatttgcgagctgtttgcttggtacgagccat 139  Q
    ||||||||||||| |||||||| |||||||| |||||    
30795 cggtggatttgcgtgctgtttgtttggtacgtgccat 30759  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7 (Bit Score: 73; Significance: 2e-33; HSPs: 2)
Name: chr7
Description:

Target: chr7; HSP #1
Raw Score: 73; E-Value: 2e-33
Query Start/End: Original strand, 3 - 139
Target Start/End: Complemental strand, 21317457 - 21317321
Alignment:
3 gttccaggacggaatctgtgtggcttcttgactcctccggttgccggagcagatttccgggcagctttggtggcaagctgtttccttggtgcttttccgc 102  Q
    ||||| |||||||| | |||||||||||| ||||||||||| |||||||| |||||||| || ||||||||||| || ||||| | ||| ||||||||||    
21317457 gttccgggacggaaacggtgtggcttcttcactcctccggtcgccggagctgatttccgtgcggctttggtggcgagttgtttgcgtggggcttttccgc 21317358  T
103 cggtggatttgcgagctgtttgcttggtacgagccat 139  Q
    ||||||||||||| |||||||| |||||||| |||||    
21317357 cggtggatttgcgtgctgtttgtttggtacgtgccat 21317321  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #2
Raw Score: 57; E-Value: 6e-24
Query Start/End: Original strand, 3 - 139
Target Start/End: Original strand, 3930206 - 3930342
Alignment:
3 gttccaggacggaatctgtgtggcttcttgactcctccggttgccggagcagatttccgggcagctttggtggcaagctgtttccttggtgcttttccgc 102  Q
    ||||| ||||||||||||||||| ||||| || || ||||||||||| || ||||| |  || ||||||||||| || ||||||| ||| |||||||| |    
3930206 gttcctggacggaatctgtgtggtttctttacaccaccggttgccggtgctgattttcttgcggctttggtggcgagttgtttccgtggggcttttcctc 3930305  T
103 cggtggatttgcgagctgtttgcttggtacgagccat 139  Q
    |||||||||| || |||||||| |||||||| |||||    
3930306 cggtggattttcgtgctgtttgtttggtacgtgccat 3930342  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2 (Bit Score: 73; Significance: 2e-33; HSPs: 2)
Name: chr2
Description:

Target: chr2; HSP #1
Raw Score: 73; E-Value: 2e-33
Query Start/End: Original strand, 3 - 139
Target Start/End: Complemental strand, 13576231 - 13576095
Alignment:
3 gttccaggacggaatctgtgtggcttcttgactcctccggttgccggagcagatttccgggcagctttggtggcaagctgtttccttggtgcttttccgc 102  Q
    |||||||||||||| |  ||||||||||| ||||||||||| |||||||| |||||||| || ||||| ||||| || ||||| | ||||||||||||||    
13576231 gttccaggacggaaacgatgtggcttcttcactcctccggtggccggagcggatttccgagcggcttttgtggcgagttgtttgcgtggtgcttttccgc 13576132  T
103 cggtggatttgcgagctgtttgcttggtacgagccat 139  Q
    ||||||||||||| |||||||| |||||||| |||||    
13576131 cggtggatttgcgggctgtttgtttggtacgtgccat 13576095  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #2
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 84 - 139
Target Start/End: Original strand, 34571802 - 34571857
Alignment:
84 ttccttggtgcttttccgccggtggatttgcgagctgtttgcttggtacgagccat 139  Q
    ||||||||||| || || ||||||||||||||||| |||||||| ||||| |||||    
34571802 ttccttggtgccttgccaccggtggatttgcgagcagtttgctttgtacgcgccat 34571857  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4 (Bit Score: 69; Significance: 4e-31; HSPs: 2)
Name: chr4
Description:

Target: chr4; HSP #1
Raw Score: 69; E-Value: 4e-31
Query Start/End: Original strand, 3 - 139
Target Start/End: Complemental strand, 24860429 - 24860293
Alignment:
3 gttccaggacggaatctgtgtggcttcttgactcctccggttgccggagcagatttccgggcagctttggtggcaagctgtttccttggtgcttttccgc 102  Q
    ||||| |||||||| | ||| || ||||| ||||| ||||| || ||||| ||||||||||| ||||| || || ||||| ||||||||||||||||| |    
24860429 gttccgggacggaaacggtgaggtttcttcactccgccggtggctggagcggatttccgggcggcttttgttgctagctgcttccttggtgcttttcctc 24860330  T
103 cggtggatttgcgagctgtttgcttggtacgagccat 139  Q
    ||||||||||||||||||||||||| |||||||||||    
24860329 cggtggatttgcgagctgtttgctttgtacgagccat 24860293  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #2
Raw Score: 49; E-Value: 4e-19
Query Start/End: Original strand, 27 - 139
Target Start/End: Complemental strand, 34748614 - 34748502
Alignment:
27 ttcttgactcctccggttgccggagcagatttccgggcagctttggtggcaagctgtttccttggtgcttttccgccggtggatttgcgagctgtttgct 126  Q
    ||||| ||||| ||||| |||||||||||||| || || ||||| ||||| || || |||||||| ||||| || || |||||||||||||| |||||||    
34748614 ttcttcactccaccggtggccggagcagatttgcgagcggcttttgtggctagttgcttccttggagctttacctccagtggatttgcgagcggtttgct 34748515  T
127 tggtacgagccat 139  Q
    ||||||| |||||    
34748514 tggtacgtgccat 34748502  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1 (Bit Score: 37; Significance: 0.000000000005; HSPs: 1)
Name: chr1
Description:

Target: chr1; HSP #1
Raw Score: 37; E-Value: 0.000000000005
Query Start/End: Original strand, 69 - 141
Target Start/End: Original strand, 7594907 - 7594979
Alignment:
69 ttggtggcaagctgtttccttggtgcttttccgccggtggatttgcgagctgtttgcttggtacgagccatgg 141  Q
    |||||||| ||||| |||||||| || || || ||||| || |||||||| ||||||||||||||||||||||    
7594907 ttggtggcgagctgcttccttggagccttaccaccggtagacttgcgagcggtttgcttggtacgagccatgg 7594979  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University