View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8354_low_5 (Length: 391)
Name: NF8354_low_5
Description: NF8354
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8354_low_5 |
 | |
|
| [»] chr4 (1 HSPs) |
| |
|
Alignment Details
Target: chr4 (Bit Score: 278; Significance: 1e-155; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 278; E-Value: 1e-155
Query Start/End: Original strand, 78 - 391
Target Start/End: Original strand, 846991 - 847304
Alignment:
| Q |
78 |
aagacggaagaatcttaatatcactatttttaacgatatgtttctatgtatgtatttttctgctaccagtttcaaagcaagactactttggtcgtagcca |
177 |
Q |
| |
|
|||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| | |
|
|
| T |
846991 |
aagacgtaagaatcttaatatcactatttttaacgatatgtttctatgtatgtatttttctgctaccagtttcaaagcaagactactttggtcgtagcta |
847090 |
T |
|
| Q |
178 |
cattaggacaatgcttgaatttattttcagtatttgtctgtatgtgtataagttgcctgctttgttttatgcagtaacttttgtgttttgtgtgtgtaat |
277 |
Q |
| |
|
|| |||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
847091 |
cactaggacaatgcttgaatttattttcagtatttgtctgtgtgtgtataagttgcctgctttgttttatgcagtaacttttgtgttttgtgtgtgtaat |
847190 |
T |
|
| Q |
278 |
tattttctgcagatattatgaaggtgccgtcagtgcttattatcatgtcaacggaaagcacaaggtgttgtatgtcgattgcgttgacgaacagataaat |
377 |
Q |
| |
|
||||||||||||||||||||||||||| |||||||||||| ||||||||||||||||||||||||||||||||| |||| ||||||| |||||||||||| |
|
|
| T |
847191 |
tattttctgcagatattatgaaggtgctgtcagtgcttatgatcatgtcaacggaaagcacaaggtgttgtatgacgatggcgttgaggaacagataaat |
847290 |
T |
|
| Q |
378 |
ctcaagaaacatcg |
391 |
Q |
| |
|
|||||||||||||| |
|
|
| T |
847291 |
ctcaagaaacatcg |
847304 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University