View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8355_low_19 (Length: 231)
Name: NF8355_low_19
Description: NF8355
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8355_low_19 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 184; Significance: 1e-99; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 184; E-Value: 1e-99
Query Start/End: Original strand, 12 - 213
Target Start/End: Complemental strand, 25414653 - 25414455
Alignment:
| Q |
12 |
aacctgtgtcattcacacaaaatagcaacaataataggttaggtcgttagcacccaaataaatttcattaacacattctccttttgatttaaattatagt |
111 |
Q |
| |
|
||||||||||||||||||||||||||||||||| |||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
25414653 |
aacctgtgtcattcacacaaaatagcaacaata---ggttaggtcgttagaacccaaataaatttcattaacacattctccttttgatttaaattatagt |
25414557 |
T |
|
| Q |
112 |
gtagcatattatttttggaatgtatcctacttgaataggttaggacccaaataaattttatgtgatgggtgaattgtttgttagaagagataaaatctga |
211 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
25414556 |
gtagcatattatttttggaatgtatcctacttgaataggttaggacccaaataaattttatgtgatgggtgaattgtttgttagaagagataaaatctga |
25414457 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University