View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF8355_low_20 (Length: 217)

Name: NF8355_low_20
Description: NF8355
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF8355_low_20
NF8355_low_20
[»] chr3 (1 HSPs)
chr3 (150-204)||(34476199-34476253)
[»] chr7 (1 HSPs)
chr7 (150-204)||(25160397-25160451)


Alignment Details
Target: chr3 (Bit Score: 51; Significance: 2e-20; HSPs: 1)
Name: chr3
Description:

Target: chr3; HSP #1
Raw Score: 51; E-Value: 2e-20
Query Start/End: Original strand, 150 - 204
Target Start/End: Complemental strand, 34476253 - 34476199
Alignment:
150 tcgcggatccagtgccgaaacgctttgtgaaagggagctttctcgggggtgatgt 204  Q
    |||||||||| ||||||||||||||||||||||||||||||||||||||||||||    
34476253 tcgcggatccggtgccgaaacgctttgtgaaagggagctttctcgggggtgatgt 34476199  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7 (Bit Score: 43; Significance: 0.000000000000001; HSPs: 1)
Name: chr7
Description:

Target: chr7; HSP #1
Raw Score: 43; E-Value: 0.000000000000001
Query Start/End: Original strand, 150 - 204
Target Start/End: Original strand, 25160397 - 25160451
Alignment:
150 tcgcggatccagtgccgaaacgctttgtgaaagggagctttctcgggggtgatgt 204  Q
    |||||||||| |||||||||||||||| ||||| |||||||||||||||||||||    
25160397 tcgcggatccggtgccgaaacgctttgcgaaagagagctttctcgggggtgatgt 25160451  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University