View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8355_low_20 (Length: 217)
Name: NF8355_low_20
Description: NF8355
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8355_low_20 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 51; Significance: 2e-20; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 51; E-Value: 2e-20
Query Start/End: Original strand, 150 - 204
Target Start/End: Complemental strand, 34476253 - 34476199
Alignment:
| Q |
150 |
tcgcggatccagtgccgaaacgctttgtgaaagggagctttctcgggggtgatgt |
204 |
Q |
| |
|
|||||||||| |||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
34476253 |
tcgcggatccggtgccgaaacgctttgtgaaagggagctttctcgggggtgatgt |
34476199 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7 (Bit Score: 43; Significance: 0.000000000000001; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 43; E-Value: 0.000000000000001
Query Start/End: Original strand, 150 - 204
Target Start/End: Original strand, 25160397 - 25160451
Alignment:
| Q |
150 |
tcgcggatccagtgccgaaacgctttgtgaaagggagctttctcgggggtgatgt |
204 |
Q |
| |
|
|||||||||| |||||||||||||||| ||||| ||||||||||||||||||||| |
|
|
| T |
25160397 |
tcgcggatccggtgccgaaacgctttgcgaaagagagctttctcgggggtgatgt |
25160451 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University