View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8355_low_21 (Length: 209)
Name: NF8355_low_21
Description: NF8355
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8355_low_21 |
 | |
|
Alignment Details
Target: chr6 (Bit Score: 144; Significance: 7e-76; HSPs: 2)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 144; E-Value: 7e-76
Query Start/End: Original strand, 19 - 195
Target Start/End: Complemental strand, 1901931 - 1901747
Alignment:
| Q |
19 |
tcatgtttctgtcacttgcacaacaatcacaaaccttgatgaacttcagaatttctgtgacatgttttgatgatcaggtttttattttgaccatttcttg |
118 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||| ||| |
|
|
| T |
1901931 |
tcatgtttctgtcacttgcacaacaatcacaaaccttgatgaacttcagaatttctgtgacatgttttgatgatcaggttttgattttgaccattttttg |
1901832 |
T |
|
| Q |
119 |
aaccaaaataaaatataaagctattactattaaattcatag--------atatattgattttttgacatactatataagaataat |
195 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| |||| |||||||||||||||||||||||||||||||||||| |
|
|
| T |
1901831 |
aaccaaaataaaatataaagctattactattaaattgatagagtatattatatattgattttttgacatactatataagaataat |
1901747 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #2
Raw Score: 40; E-Value: 0.00000000000008
Query Start/End: Original strand, 19 - 74
Target Start/End: Complemental strand, 1895520 - 1895465
Alignment:
| Q |
19 |
tcatgtttctgtcacttgcacaacaatcacaaaccttgatgaacttcagaatttct |
74 |
Q |
| |
|
|||||||||| |||||| ||||||||| |||||||||| ||||||||||||||||| |
|
|
| T |
1895520 |
tcatgtttctatcacttacacaacaattacaaaccttggtgaacttcagaatttct |
1895465 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University