View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8355_low_7 (Length: 342)
Name: NF8355_low_7
Description: NF8355
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8355_low_7 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 256; Significance: 1e-142; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 256; E-Value: 1e-142
Query Start/End: Original strand, 11 - 329
Target Start/End: Original strand, 40116795 - 40117098
Alignment:
| Q |
11 |
cagagagtttgattgcccaacgaggaaggttttgataaccgaatcgcattgattggttgattgatggttgtgtgaaccaattttcagatgcgattgatga |
110 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||| |
|
|
| T |
40116795 |
cagagagtttgattgcccaacgaggaaggttttgataaccgaatcgcattgattggttgattgatggttgtgtgaaccaattttcagaagcgattgatga |
40116894 |
T |
|
| Q |
111 |
gagtaagcgggattgtttgtgggatgatatgaagtttcttactatccataacccttttactttttctatgcgttcccatttctttagattcgaatagcaa |
210 |
Q |
| |
|
||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||| |
|
|
| T |
40116895 |
gagtaagcgggattgtttgtgggatgataggaagtttcttactatccataacccttttactttttctatgcgttcccat---------ttcgaatagcaa |
40116985 |
T |
|
| Q |
211 |
ttatcagaatctgaatcgaaggaggaatcggaggaggaatcggaggagtggccgaagacttgttccaaaattgcttgctgctcgtactcgtcgtcttcat |
310 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
40116986 |
ttatcagaatctgaatcgaaggaggaatcggagga------ggaggagtggccgaagacttgttccaaaattgcttgctgctcgtactcgtcgtcttcat |
40117079 |
T |
|
| Q |
311 |
ctttgctcatcttcttctt |
329 |
Q |
| |
|
||||||||||||||||||| |
|
|
| T |
40117080 |
ctttgctcatcttcttctt |
40117098 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University