View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8356_low_4 (Length: 218)
Name: NF8356_low_4
Description: NF8356
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8356_low_4 |
 | |
|
Alignment Details
Target: chr6 (Bit Score: 181; Significance: 6e-98; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 181; E-Value: 6e-98
Query Start/End: Original strand, 5 - 201
Target Start/End: Complemental strand, 19698692 - 19698496
Alignment:
| Q |
5 |
tctatgttgttttgtgcgggtatttgtgtactcatattgttaggggtatgtaaaatataaagctgattttgttcgtgggagaaacaagtgttgatgttaa |
104 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||| |||| |||||||||||||||||||||||||| |
|
|
| T |
19698692 |
tctatgttgttttgtgcgggtatttgtgtactcatattgttaggggtatgtaatatataaagctgattgtgtttgtgggagaaacaagtgttgatgttaa |
19698593 |
T |
|
| Q |
105 |
ggtgctaaatgattaagatgtttcgtaattgtggatgtttacggtgttctttagaccccttctaggagatatatagcttaagctcatggaggaaaat |
201 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||| |
|
|
| T |
19698592 |
ggtgctaaatgattaagatgtttcgtaattgtggatgtttacggtgttctttagaccccttctaggagatatatagcttaagctcgtggaggaaaat |
19698496 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University