View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8357_high_3 (Length: 254)
Name: NF8357_high_3
Description: NF8357
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8357_high_3 |
 | |
|
| [»] chr1 (1 HSPs) |
| |
|
Alignment Details
Target: chr1 (Bit Score: 235; Significance: 1e-130; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 235; E-Value: 1e-130
Query Start/End: Original strand, 12 - 254
Target Start/End: Original strand, 42685007 - 42685249
Alignment:
| Q |
12 |
ttggtgttattgatggaacttcagaggctattttccatactcttatgtctcttgatccctcaagatcggagtaagtattccaaatcactttatggttcta |
111 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
42685007 |
ttggtgttattgatggaacttcagaggctattttccatactcttatgtctcttgatccctcaagatcggagtaagtattccaaatcactttatggttcta |
42685106 |
T |
|
| Q |
112 |
tttattgctattctgttgcatgcaatgcaaatgctcaagaacattacttatcttgatatgctatatataatttgtttaatacttgaaaacacaaattagc |
211 |
Q |
| |
|
|||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||| |
|
|
| T |
42685107 |
tttattactattctgttgcatgcaatgcaaatgctcaagaacattacttatcttgatatgctatatataatttgtttaacacttgaaaacacaaattagc |
42685206 |
T |
|
| Q |
212 |
tactataggacatggtctaaaattttagcaacttctgtctaat |
254 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
42685207 |
tactataggacatggtctaaaattttagcaacttctgtctaat |
42685249 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2 (Bit Score: 37; Significance: 0.000000000006; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 37; E-Value: 0.000000000006
Query Start/End: Original strand, 23 - 87
Target Start/End: Complemental strand, 40400136 - 40400072
Alignment:
| Q |
23 |
gatggaacttcagaggctattttccatactcttatgtctcttgatccctcaagatcggagtaagt |
87 |
Q |
| |
|
|||||||||||||| || |||||||| ||||||||||| |||| ||| |||||||| |||||||| |
|
|
| T |
40400136 |
gatggaacttcagaagccattttccagactcttatgtcacttggtccttcaagatcagagtaagt |
40400072 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University