View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8357_low_7 (Length: 234)
Name: NF8357_low_7
Description: NF8357
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8357_low_7 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 198; Significance: 1e-108; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 198; E-Value: 1e-108
Query Start/End: Original strand, 1 - 222
Target Start/End: Complemental strand, 21508508 - 21508287
Alignment:
| Q |
1 |
tttcttcattgaattgaatcgactcgaacgtggtttgttccatcgttcaactgaaccaaaccgaaatgaaacggttcgagaaaactccgaaaacccaaaa |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||| ||||| ||||||||||||||||||||||| |
|
|
| T |
21508508 |
tttcttcattgaattgaatcgactcgaacgtggtttgttccatcgtttaactgaaccaaaccgaaatgaaccggtttgagaaaactccgaaaacccaaaa |
21508409 |
T |
|
| Q |
101 |
accggagttaactgtgtaagttgttgggggagaatgaaggagggaaagaaagagagtggaaaaagagtgaaatgtgtgttttataatgtgcttattattt |
200 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| | |||||||||||||||||||||||||| |
|
|
| T |
21508408 |
accggagttaactgtgtaagttgttgggggagaatgaaggagggaaagaaagagagtggaaaaagagtgaagtctgtgttttataatgtgcttattattt |
21508309 |
T |
|
| Q |
201 |
ttattctgtgttggttcttctc |
222 |
Q |
| |
|
|| ||||||||||||||||||| |
|
|
| T |
21508308 |
ttgttctgtgttggttcttctc |
21508287 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University