View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8358_low_3 (Length: 272)
Name: NF8358_low_3
Description: NF8358
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8358_low_3 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 241; Significance: 1e-133; HSPs: 3)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 241; E-Value: 1e-133
Query Start/End: Original strand, 1 - 253
Target Start/End: Original strand, 6609617 - 6609869
Alignment:
| Q |
1 |
catccctatgtaacacaaaaatgaaataacaaatcaacacataatattattaaagaataattttaacgatctaacggtatattaattgacagtgtaaaca |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||| | |
|
|
| T |
6609617 |
catccctatgtaacacaaaaatgaaataacaaatcaacacataatattattaaagaataattttaacgatccaacggtatattaattgacagtgtaaaaa |
6609716 |
T |
 |
| Q |
101 |
atcatggaaatgaagagacttaattacattgacaaaacaatcatggaaatgaaggcgcaagagagaagcagcaatccttgagtcattagctatagctgac |
200 |
Q |
| |
|
|| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
6609717 |
ataatggaaatgaagagacttaattacattgacaaaacaatcatggaaatgaaggcgcaagagagaagcagcaatccttgagtcattagctatagctgac |
6609816 |
T |
 |
| Q |
201 |
aagatattatttttaacaattctgttcaggtttggacaagttctaatgtagaa |
253 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
6609817 |
aagatattatttttaacaattctgttcaggtttggacaagttctaatgtagaa |
6609869 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 99; E-Value: 6e-49
Query Start/End: Original strand, 119 - 257
Target Start/End: Original strand, 6602220 - 6602358
Alignment:
| Q |
119 |
cttaattacattgacaaaacaatcatggaaatgaaggcgcaagagagaagcagcaatccttgagtcattagctatagctgacaagatattatttttaaca |
218 |
Q |
| |
|
|||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||| || |||||||||||||||||||||||||| | ||||||| |
|
|
| T |
6602220 |
cttaattacattaacaaaacaatcatggaaatgaaggcgcaagagagaagcagcaatcctagaatcattagctatagctgacaagatattgtctttaaca |
6602319 |
T |
 |
| Q |
219 |
attctgttcaggtttggacaagttctaatgtagaaattg |
257 |
Q |
| |
|
||| ||||||| |||||||||||||| | ||||||||| |
|
|
| T |
6602320 |
attttgttcagatttggacaagttctgttatagaaattg |
6602358 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #3
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 1 - 29
Target Start/End: Original strand, 6602115 - 6602143
Alignment:
| Q |
1 |
catccctatgtaacacaaaaatgaaataa |
29 |
Q |
| |
|
||||||||||||||||||||||||||||| |
|
|
| T |
6602115 |
catccctatgtaacacaaaaatgaaataa |
6602143 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University