View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8359_high_5 (Length: 327)
Name: NF8359_high_5
Description: NF8359
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8359_high_5 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 212; Significance: 1e-116; HSPs: 2)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 212; E-Value: 1e-116
Query Start/End: Original strand, 18 - 229
Target Start/End: Complemental strand, 32482367 - 32482156
Alignment:
| Q |
18 |
atatgtctccttgttatggttgggaaaagagtatagtaattgaattgaattgaagttaataagaaaaagaaggacagaaaacagaaacagacggctaaac |
117 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32482367 |
atatgtctccttgttatggttgggaaaagagtatagtaattgaattgaattgaagttaataagaaaaagaaggacagaaaacagaaacagacggctaaac |
32482268 |
T |
 |
| Q |
118 |
agtgtcgtggcagcaagcagcgttaatcacgctttcaatatcacttcccagctagcagctatagcttccttcaacgtttgtttttgtgtaatactcctaa |
217 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32482267 |
agtgtcgtggcagcaagcagcgttaatcacgctttcaatatcacttcccagctagcagctatagcttccttcaacgtttgtttttgtgtaatactcctaa |
32482168 |
T |
 |
| Q |
218 |
cttatgtttttt |
229 |
Q |
| |
|
|||||||||||| |
|
|
| T |
32482167 |
cttatgtttttt |
32482156 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 41; E-Value: 0.00000000000003
Query Start/End: Original strand, 273 - 313
Target Start/End: Complemental strand, 32482111 - 32482071
Alignment:
| Q |
273 |
aggaaggaacagtaccacagtctttttacagctatctctgc |
313 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32482111 |
aggaaggaacagtaccacagtctttttacagctatctctgc |
32482071 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University