View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8359_high_6 (Length: 326)
Name: NF8359_high_6
Description: NF8359
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8359_high_6 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 122; Significance: 1e-62; HSPs: 2)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 122; E-Value: 1e-62
Query Start/End: Original strand, 133 - 310
Target Start/End: Complemental strand, 3721696 - 3721506
Alignment:
| Q |
133 |
gttaggtgattgagagatatgtggaaaaactttacggtattaccctttttgagtttgnnnnnnngttagtttctaaaacgtgatttcttatggttggttc |
232 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||| |
|
|
| T |
3721696 |
gttaggtgattgagagatatgtggaaaaactttacggtattaccctttttgagtttgtttttttgttagtttctaaaacgtgatttcttatggttggttc |
3721597 |
T |
 |
| Q |
233 |
atatctttttgggttattttttat-------------ttaaataaatccaagactatgggaatgagattttgtgtggctgagtaatatatc |
310 |
Q |
| |
|
|||||||||||||||||||||| | |||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
3721596 |
atatctttttgggttattttttgtttatttaaatccattaaataaatccaagactatgggaatgagattttgtgtggctgagtaatatatc |
3721506 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 69 - 103
Target Start/End: Complemental strand, 3721760 - 3721726
Alignment:
| Q |
69 |
gttcaatgtcaatgataccctctcttctcttctta |
103 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| |
|
|
| T |
3721760 |
gttcaatgtcaatgataccctctcttctcttctta |
3721726 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University