View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF8359_high_6 (Length: 326)

Name: NF8359_high_6
Description: NF8359
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF8359_high_6
NF8359_high_6
[»] chr8 (2 HSPs)
chr8 (133-310)||(3721506-3721696)
chr8 (69-103)||(3721726-3721760)


Alignment Details
Target: chr8 (Bit Score: 122; Significance: 1e-62; HSPs: 2)
Name: chr8
Description:

Target: chr8; HSP #1
Raw Score: 122; E-Value: 1e-62
Query Start/End: Original strand, 133 - 310
Target Start/End: Complemental strand, 3721696 - 3721506
Alignment:
133 gttaggtgattgagagatatgtggaaaaactttacggtattaccctttttgagtttgnnnnnnngttagtttctaaaacgtgatttcttatggttggttc 232  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||       ||||||||||||||||||||||||||||||||||||    
3721696 gttaggtgattgagagatatgtggaaaaactttacggtattaccctttttgagtttgtttttttgttagtttctaaaacgtgatttcttatggttggttc 3721597  T
233 atatctttttgggttattttttat-------------ttaaataaatccaagactatgggaatgagattttgtgtggctgagtaatatatc 310  Q
    |||||||||||||||||||||| |             ||||||||||||||||||||||||||||||||||||||||||||||||||||||    
3721596 atatctttttgggttattttttgtttatttaaatccattaaataaatccaagactatgggaatgagattttgtgtggctgagtaatatatc 3721506  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #2
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 69 - 103
Target Start/End: Complemental strand, 3721760 - 3721726
Alignment:
69 gttcaatgtcaatgataccctctcttctcttctta 103  Q
    |||||||||||||||||||||||||||||||||||    
3721760 gttcaatgtcaatgataccctctcttctcttctta 3721726  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University