View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8360_high_2 (Length: 336)
Name: NF8360_high_2
Description: NF8360
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8360_high_2 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 88; Significance: 3e-42; HSPs: 2)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 88; E-Value: 3e-42
Query Start/End: Original strand, 20 - 131
Target Start/End: Complemental strand, 9028026 - 9027915
Alignment:
| Q |
20 |
cctatatgtcttcacaatgggatagtctaggcctcccatcctttaaactttctcatgtgtatattagttcatgttctcaccatattcttttatttcattt |
119 |
Q |
| |
|
|||||||||||||| |||||||||||||||||||||||||||||| ||||||||||||||| |||| |||| |||||||||||||||||||||||||||| |
|
|
| T |
9028026 |
cctatatgtcttcataatgggatagtctaggcctcccatcctttagactttctcatgtgtaaattaattcaagttctcaccatattcttttatttcattt |
9027927 |
T |
|
| Q |
120 |
attaacttttat |
131 |
Q |
| |
|
|| ||||||||| |
|
|
| T |
9027926 |
atgaacttttat |
9027915 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 55; E-Value: 1e-22
Query Start/End: Original strand, 201 - 255
Target Start/End: Complemental strand, 9027817 - 9027763
Alignment:
| Q |
201 |
ctattgaaactcaagcaatgtgtagtttataaaatagacaagctcatgtatgtgt |
255 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
9027817 |
ctattgaaactcaagcaatgtgtagtttataaaatagacaagctcatgtatgtgt |
9027763 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University