View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8360_low_12 (Length: 212)
Name: NF8360_low_12
Description: NF8360
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8360_low_12 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 181; Significance: 6e-98; HSPs: 2)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 181; E-Value: 6e-98
Query Start/End: Original strand, 17 - 197
Target Start/End: Original strand, 11810666 - 11810846
Alignment:
| Q |
17 |
ataaccttctaatccaatccacatgctttggtgtttcttcatttttctcccaatctaccaaatattggataccataaatgatcccatttctatgtggaaa |
116 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
11810666 |
ataaccttctaatccaatccacatgctttggtgtttcttcatttttctcccaatctaccaaatattggataccataaatgatcccatttctatgtggaaa |
11810765 |
T |
|
| Q |
117 |
tggagtttctgtttctgaaatctcactcattctccctccatatggtgtcataatcaaagttggtctgtcttcttcaagtat |
197 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
11810766 |
tggagtttctgtttctgaaatctcactcattctccctccatatggtgtcataatcaaagttggtctgtcttcttcaagtat |
11810846 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 128; E-Value: 2e-66
Query Start/End: Original strand, 17 - 196
Target Start/End: Original strand, 11802922 - 11803101
Alignment:
| Q |
17 |
ataaccttctaatccaatccacatgctttggtgtttcttcatttttctcccaatctaccaaatattggataccataaatgatcccatttctatgtggaaa |
116 |
Q |
| |
|
|||||||||| |||||||||| |||||||||||||||||||||| ||||||| || |||||||||||||||||||||||||||||||||||| ||||| |
|
|
| T |
11802922 |
ataaccttctcatccaatccatatgctttggtgtttcttcatttgaatcccaatttatcaaatattggataccataaatgatcccatttctatgcggaaa |
11803021 |
T |
|
| Q |
117 |
tggagtttctgtttctgaaatctcactcattctccctccatatggtgtcataatcaaagttggtctgtcttcttcaagta |
196 |
Q |
| |
|
||||||||||| |||||||||||||| ||||||||||||||||||||||||||||||||||||| ||| |||||||||| |
|
|
| T |
11803022 |
tggagtttctgattctgaaatctcacccattctccctccatatggtgtcataatcaaagttggtttgttctcttcaagta |
11803101 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University