View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8360_low_4 (Length: 339)
Name: NF8360_low_4
Description: NF8360
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8360_low_4 |
 | |
|
| [»] scaffold0421 (1 HSPs) |
| | |
|
Alignment Details
Target: chr2 (Bit Score: 159; Significance: 1e-84; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 159; E-Value: 1e-84
Query Start/End: Original strand, 167 - 325
Target Start/End: Original strand, 42211920 - 42212078
Alignment:
| Q |
167 |
actttttgtgacgtgcactttctctgtccttttctacggttttcattttctctcaaatctaaacccttcttctcacactttttgcaactgtcacgtgtgg |
266 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
42211920 |
actttttgtgacgtgcactttctctgtccttttctacggttttcattttctctcaaatctaaacccttcttctcacactttttgcaactgtcacgtgtgg |
42212019 |
T |
|
| Q |
267 |
ttttcaatacaattttaaggtaacttgttattatattttctctttcatctttttatttt |
325 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
42212020 |
ttttcaatacaattttaaggtaacttgttattatattttctctttcatctttttatttt |
42212078 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0421 (Bit Score: 112; Significance: 1e-56; HSPs: 1)
Name: scaffold0421
Description:
Target: scaffold0421; HSP #1
Raw Score: 112; E-Value: 1e-56
Query Start/End: Original strand, 37 - 164
Target Start/End: Complemental strand, 13397 - 13270
Alignment:
| Q |
37 |
tttttgtttgttggatctattcttttctttattatcattatttacaaagttaaattttttaatatttccatgccatgtcattggtggtagaaaagggtgt |
136 |
Q |
| |
|
|||| |||||||||||||||||||||||||||||||||| |||||| |||||||||||||||||||||||||||||||||| |||||||||||||||||| |
|
|
| T |
13397 |
ttttcgtttgttggatctattcttttctttattatcattctttacatagttaaattttttaatatttccatgccatgtcatcggtggtagaaaagggtgt |
13298 |
T |
|
| Q |
137 |
accaaaagagtggtacatgaatcttttt |
164 |
Q |
| |
|
|||||||||||||||||||||||||||| |
|
|
| T |
13297 |
accaaaagagtggtacatgaatcttttt |
13270 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3 (Bit Score: 68; Significance: 2e-30; HSPs: 2)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 68; E-Value: 2e-30
Query Start/End: Original strand, 50 - 157
Target Start/End: Original strand, 47345444 - 47345551
Alignment:
| Q |
50 |
gatctattcttttctttattatcattatttacaaagttaaattttttaatatttccatgccatgtcattggtggtagaaaagggtgtaccaaaagagtgg |
149 |
Q |
| |
|
||||||||||||||||| |||||||| |||||||||||||||| ||||||||||||||| |||||||| ||| || ||||||||||||||||||||| |
|
|
| T |
47345444 |
gatctattcttttcttttttatcattctttacaaagttaaattgtttaatatttccatgtcatgtcatcagtgctataaaagggtgtaccaaaagagtaa |
47345543 |
T |
|
| Q |
150 |
tacatgaa |
157 |
Q |
| |
|
|||||||| |
|
|
| T |
47345544 |
tacatgaa |
47345551 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 32; E-Value: 0.000000008
Query Start/End: Original strand, 50 - 89
Target Start/End: Complemental strand, 3798110 - 3798071
Alignment:
| Q |
50 |
gatctattcttttctttattatcattatttacaaagttaa |
89 |
Q |
| |
|
||||||||||||||||| |||||||| ||||||||||||| |
|
|
| T |
3798110 |
gatctattcttttcttttttatcattctttacaaagttaa |
3798071 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University