View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8361_low_10 (Length: 282)
Name: NF8361_low_10
Description: NF8361
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8361_low_10 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 223; Significance: 1e-123; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 223; E-Value: 1e-123
Query Start/End: Original strand, 16 - 275
Target Start/End: Original strand, 33625029 - 33625284
Alignment:
| Q |
16 |
agaaatttgatgtatgatagataatagacataacataaggttgttatctaaccatgcttgccctttagagctgggcttttctgaagatgacattttgata |
115 |
Q |
| |
|
||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||| |
|
|
| T |
33625029 |
agaaatttgatgtatgata----atagacataacataaggttgttatctaaccatgcttgccctttagagctgggcttttctgcagatgacattttgata |
33625124 |
T |
 |
| Q |
116 |
tgtaagaatatatgattctttgtttaggaatatgaaattaggttactggaaaggcagatccatgagtatcactaagatggtaaaaaattcagttagaact |
215 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
33625125 |
tgtaagaatatatgattctttgtttaggaatatgaaattaggttactggaaagtcagatccatgagtatcactaagatggtaaaaaattcagttagaact |
33625224 |
T |
 |
| Q |
216 |
ggagacactgaaaatattgtggctgtgagatattgaaagggtataagcgtgtgtgcggtg |
275 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| ||||||||||| ||||||| |||| |
|
|
| T |
33625225 |
ggagacactgaaaatattgtggctgtgagatattggaagggtataagtgtgtgtgtggtg |
33625284 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University