View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8361_low_11 (Length: 259)
Name: NF8361_low_11
Description: NF8361
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8361_low_11 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 147; Significance: 1e-77; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 147; E-Value: 1e-77
Query Start/End: Original strand, 25 - 247
Target Start/End: Original strand, 51124221 - 51124430
Alignment:
| Q |
25 |
gatcctttcacccaatagtttggatatgaattgatggtccaactatcttttagcataagatatgatcacgaggtcaaatttaactttaaaaatgtatcga |
124 |
Q |
| |
|
|||||||||| |||| |||||||||||||||||||| |||||||||||||||||||||||| |||||||||| ||||||| ||||||||||||||||||| |
|
|
| T |
51124221 |
gatcctttcatccaagagtttggatatgaattgatgatccaactatcttttagcataagatgtgatcacgagttcaaattcaactttaaaaatgtatcga |
51124320 |
T |
 |
| Q |
125 |
ttagtctaaacaattgtccattataattctattcagattgagtaattatatttgcacgaaaatggatccattcatgcttctctctcatgtttcaaatcac |
224 |
Q |
| |
|
|||||||||||||||||||||| ||||||||| |||||||||||||||||||||||||||||||||||||| |||||||||||||||| |
|
|
| T |
51124321 |
ttagtctaaacaattgtccattgtaattctatacagattgagtaattatatttgcacgaaaatggatccat-------------tcatgtttcaaatcac |
51124407 |
T |
 |
| Q |
225 |
caacctttatccatatttatttt |
247 |
Q |
| |
|
||||||||||||||||||||||| |
|
|
| T |
51124408 |
caacctttatccatatttatttt |
51124430 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University