View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8361_low_14 (Length: 244)
Name: NF8361_low_14
Description: NF8361
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8361_low_14 |
 | |
|
Alignment Details
Target: chr6 (Bit Score: 104; Significance: 6e-52; HSPs: 2)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 104; E-Value: 6e-52
Query Start/End: Original strand, 111 - 230
Target Start/End: Original strand, 24225883 - 24226002
Alignment:
| Q |
111 |
aatagcaccatcaactgccgccttctcaacttctttgataggaaaatacctcctaattccaactttgttgacggagtagcttctcatgatgtcattgtga |
210 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||| |||||||||||||||||||| |
|
|
| T |
24225883 |
aatagcaccatcaactgccgccttctcaacttctttgataggaaaatacctcctaattccaactttgttgaaggagtatcttctcatgatgtcattgtgg |
24225982 |
T |
|
| Q |
211 |
acccccacacacaatctctg |
230 |
Q |
| |
|
||||||||| |||||||||| |
|
|
| T |
24225983 |
acccccacagacaatctctg |
24226002 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #2
Raw Score: 80; E-Value: 1e-37
Query Start/End: Original strand, 23 - 118
Target Start/End: Original strand, 24225224 - 24225319
Alignment:
| Q |
23 |
ggccttaaccaacaaacccctccttccatggttagttcgcttatttacgtctatcctctcttccgtcatctccgcctctcgccgctccaatagcac |
118 |
Q |
| |
|
|||||||||||||||||||||||||||||| |||||||||||||||||||||||| |||||| |||||| |||||||||||||||||||||||||| |
|
|
| T |
24225224 |
ggccttaaccaacaaacccctccttccatgtttagttcgcttatttacgtctatcatctctttcgtcatatccgcctctcgccgctccaatagcac |
24225319 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University