View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8361_low_15 (Length: 234)
Name: NF8361_low_15
Description: NF8361
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8361_low_15 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 83; Significance: 2e-39; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 83; E-Value: 2e-39
Query Start/End: Original strand, 63 - 167
Target Start/End: Complemental strand, 24346429 - 24346329
Alignment:
| Q |
63 |
tttaatgtaaagttaactctctccttatttatataatagatcttgttttcgtcatcatcacacacacaaacattcacaacaatgttgttcttcttacaag |
162 |
Q |
| |
|
||||||||||||||||||||| |||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
24346429 |
tttaatgtaaagttaactctc--cttatttata--atagatcttgttttcgtcatcatcacacacacaaacattcacaacaatgttgttcttcttacaag |
24346334 |
T |
 |
| Q |
163 |
actca |
167 |
Q |
| |
|
||||| |
|
|
| T |
24346333 |
actca |
24346329 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University