View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8362_high_12 (Length: 230)
Name: NF8362_high_12
Description: NF8362
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8362_high_12 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 156; Significance: 5e-83; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 156; E-Value: 5e-83
Query Start/End: Original strand, 14 - 216
Target Start/End: Complemental strand, 4286457 - 4286254
Alignment:
| Q |
14 |
ttggtggtgagtgattgtaacttatgtatttgcttgcagatgagacctcgatcgaacttgtagaacatggtactgttatgcccagtgaaaattgaacaga |
113 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||| |||||||| |||||||||||||||||||||||| |||||||||||||||| |
|
|
| T |
4286457 |
ttggtggtgagtgattgtaacttatgtatttgcttgcagatgagacctctatcgaactagtagaacatggtactgttatgcccggtgaaaattgaacaga |
4286358 |
T |
 |
| Q |
114 |
cctctacttttatgtga-nnnnnnnngctaaggttatgccatgatgggccaagggaatgataacagagtcttgtcttaaatgaagagttagcttacttaa |
212 |
Q |
| |
|
||||||| ||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
4286357 |
cctctacgtttatgtgattcttttttgctaaggttatgccatgatgggccaagggaatgataacagagtcttgtcttaaatgaagagttagcttacttaa |
4286258 |
T |
 |
| Q |
213 |
ttat |
216 |
Q |
| |
|
|||| |
|
|
| T |
4286257 |
ttat |
4286254 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University