View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8362_low_15 (Length: 207)
Name: NF8362_low_15
Description: NF8362
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8362_low_15 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 180; Significance: 2e-97; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 180; E-Value: 2e-97
Query Start/End: Original strand, 16 - 195
Target Start/End: Complemental strand, 37668218 - 37668039
Alignment:
| Q |
16 |
tggtgtttgaaagaacctagtcaaagtttattagattaataatctaaattgacagaaatacccccgacaaacttctaggaaacaaggaagcaattgcggt |
115 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
37668218 |
tggtgtttgaaagaacctagtcaaagtttattagattaataatctaaattgacagaaatacccccgacaaacttctaggaaacaaggaagcaattgcggt |
37668119 |
T |
|
| Q |
116 |
ttgtttttgttcttcacaatcaaaaagctaataattatctgttcccttgctgtcatcttataagggttcatcaaatttct |
195 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
37668118 |
ttgtttttgttcttcacaatcaaaaagctaataattatctgttcccttgctgtcatcttataagggttcatcaaatttct |
37668039 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University