View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF8362_low_8 (Length: 252)

Name: NF8362_low_8
Description: NF8362
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF8362_low_8
NF8362_low_8
[»] chr1 (3 HSPs)
chr1 (97-252)||(47691651-47691805)
chr1 (116-240)||(47680000-47680112)
chr1 (44-75)||(47691813-47691844)
[»] chr3 (1 HSPs)
chr3 (47-81)||(19973159-19973193)


Alignment Details
Target: chr1 (Bit Score: 140; Significance: 2e-73; HSPs: 3)
Name: chr1
Description:

Target: chr1; HSP #1
Raw Score: 140; E-Value: 2e-73
Query Start/End: Original strand, 97 - 252
Target Start/End: Complemental strand, 47691805 - 47691651
Alignment:
97 cacacacagtctaacgtgcttctttaaatcttctttctatctaacgtgcttacgatagtaaatcacaaaattgcacgacgaaacatatcatggataatgt 196  Q
    ||||||||||||||||||||||||||||| |||||||| ||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||    
47691805 cacacacagtctaacgtgcttctttaaatattctttctgtctaacgtgcttacgatagtaaatcacaaaattgcacgacgaa-catatcatggataatgt 47691707  T
197 gataggtaatagatatgtaaataattgggttatataaaaccatatgatatatgata 252  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
47691706 gataggtaatagatatgtaaataattgggttatataaaaccatatgatatatgata 47691651  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #2
Raw Score: 40; E-Value: 0.00000000000009
Query Start/End: Original strand, 116 - 240
Target Start/End: Complemental strand, 47680112 - 47680000
Alignment:
116 ttctttaaatcttctttctatctaacgtgcttacgatagtaaatcacaaaattgcacgacgaaacatatcatggataatgtgataggtaatagatatgta 215  Q
    ||||||| || ||| |||| |||||||||||||||||||||||| ||||||||||            |||| ||||||||||||||||||||||||| ||    
47680112 ttctttacattttcattctgtctaacgtgcttacgatagtaaattacaaaattgc------------atcacggataatgtgataggtaatagatatata 47680025  T
216 aataattgggttatataaaaccata 240  Q
    ||||  |||||||| ||||| ||||    
47680024 aatagctgggttatttaaaaacata 47680000  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #3
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 44 - 75
Target Start/End: Complemental strand, 47691844 - 47691813
Alignment:
44 ttgttatctctcatcattagttctataaacac 75  Q
    ||||||||||||||||||||||||||||||||    
47691844 ttgttatctctcatcattagttctataaacac 47691813  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3 (Bit Score: 31; Significance: 0.00000002; HSPs: 1)
Name: chr3
Description:

Target: chr3; HSP #1
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 47 - 81
Target Start/End: Original strand, 19973159 - 19973193
Alignment:
47 ttatctctcatcattagttctataaacactttctc 81  Q
    ||||| |||||||||||||||||||||||||||||    
19973159 ttatccctcatcattagttctataaacactttctc 19973193  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University