View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8363_high_6 (Length: 250)
Name: NF8363_high_6
Description: NF8363
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8363_high_6 |
 | |
|
| [»] chr8 (1 HSPs) |
| |
|
Alignment Details
Target: chr8 (Bit Score: 219; Significance: 1e-120; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 219; E-Value: 1e-120
Query Start/End: Original strand, 12 - 250
Target Start/End: Complemental strand, 25104977 - 25104739
Alignment:
| Q |
12 |
atgaaacatgacatgccactaagaaggaggttgggggcgctgagctggccgaggaaggatggaaatgagtgactgataagtaatgatgagttagttatat |
111 |
Q |
| |
|
|||||||||| ||||||||| | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
25104977 |
atgaaacatgccatgccactgataaggaggttgggggcgctgagctggccgaggaaggatggaaatgagtgactgataagtaatgatgagttagttatat |
25104878 |
T |
|
| Q |
112 |
aaggaataaatgggggacgagagaaactatctgggatttctgttttagtgagatagtgaggtcgcagataatgcttctctggtgaagggagctatttgta |
211 |
Q |
| |
|
|||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||| |
|
|
| T |
25104877 |
aaggaataaatgggggacgagaaaaactatctgggatttctgttttagtgagatagtgaggtcgcagataatgcttctccggtgaagggagctatttgta |
25104778 |
T |
|
| Q |
212 |
cagggctgttagacattgttctatcccattttattttct |
250 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
25104777 |
cagggctgttagacattgttctatcccattttattttct |
25104739 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University