View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8363_high_8 (Length: 221)
Name: NF8363_high_8
Description: NF8363
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8363_high_8 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 42; Significance: 0.000000000000005; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 42; E-Value: 0.000000000000005
Query Start/End: Original strand, 1 - 42
Target Start/End: Original strand, 16863554 - 16863595
Alignment:
| Q |
1 |
actcgtacccaagctgttctcggtaactcatttcatcaatct |
42 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
16863554 |
actcgtacccaagctgttctcggtaactcatttcatcaatct |
16863595 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 73 - 105
Target Start/End: Original strand, 16863637 - 16863669
Alignment:
| Q |
73 |
cttatgatttatgcaattgttgtatatgtttac |
105 |
Q |
| |
|
|||||||||||||||||||||||||||| |||| |
|
|
| T |
16863637 |
cttatgatttatgcaattgttgtatatggttac |
16863669 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University