View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF8363_low_12 (Length: 250)

Name: NF8363_low_12
Description: NF8363
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF8363_low_12
NF8363_low_12
[»] chr8 (1 HSPs)
chr8 (12-250)||(25104739-25104977)


Alignment Details
Target: chr8 (Bit Score: 219; Significance: 1e-120; HSPs: 1)
Name: chr8
Description:

Target: chr8; HSP #1
Raw Score: 219; E-Value: 1e-120
Query Start/End: Original strand, 12 - 250
Target Start/End: Complemental strand, 25104977 - 25104739
Alignment:
12 atgaaacatgacatgccactaagaaggaggttgggggcgctgagctggccgaggaaggatggaaatgagtgactgataagtaatgatgagttagttatat 111  Q
    |||||||||| ||||||||| | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
25104977 atgaaacatgccatgccactgataaggaggttgggggcgctgagctggccgaggaaggatggaaatgagtgactgataagtaatgatgagttagttatat 25104878  T
112 aaggaataaatgggggacgagagaaactatctgggatttctgttttagtgagatagtgaggtcgcagataatgcttctctggtgaagggagctatttgta 211  Q
    |||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||    
25104877 aaggaataaatgggggacgagaaaaactatctgggatttctgttttagtgagatagtgaggtcgcagataatgcttctccggtgaagggagctatttgta 25104778  T
212 cagggctgttagacattgttctatcccattttattttct 250  Q
    |||||||||||||||||||||||||||||||||||||||    
25104777 cagggctgttagacattgttctatcccattttattttct 25104739  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University