View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8363_low_14 (Length: 233)
Name: NF8363_low_14
Description: NF8363
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8363_low_14 |
 | |
|
| [»] scaffold0405 (1 HSPs) |
| | |
|
Alignment Details
Target: chr4 (Bit Score: 156; Significance: 5e-83; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 156; E-Value: 5e-83
Query Start/End: Original strand, 21 - 220
Target Start/End: Original strand, 6225613 - 6225812
Alignment:
| Q |
21 |
tctatggccgtattttactgtatctgtaggagtgtaattgtggttggatttgtaataggnnnnnnnnatatccaataaaatttaggatttctatttcaaa |
120 |
Q |
| |
|
||||||||||||||||||||| |||||| |||||| ||||||||||||||||||| ||| |||| |||||||||||||||||||||||||||| |
|
|
| T |
6225613 |
tctatggccgtattttactgtgtctgtaagagtgtgattgtggttggatttgtaaaaggttttttttatattcaataaaatttaggatttctatttcaaa |
6225712 |
T |
|
| Q |
121 |
atacggttctcaaaatgtagtgttcactgctcacttttcttgcggcagacctcatctctccactgcttccaccgccatgccaggacctgacttacttgat |
220 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
6225713 |
atacggttctcaaaatgtagtgttcactgctcacttttcttgcggcagacctcatctctccactgcttccaccgccatgccaggacctgacttacttgat |
6225812 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0405 (Bit Score: 40; Significance: 0.00000000000008; HSPs: 1)
Name: scaffold0405
Description:
Target: scaffold0405; HSP #1
Raw Score: 40; E-Value: 0.00000000000008
Query Start/End: Original strand, 158 - 217
Target Start/End: Complemental strand, 13083 - 13024
Alignment:
| Q |
158 |
tcttgcggcagacctcatctctccactgcttccaccgccatgccaggacctgacttactt |
217 |
Q |
| |
|
|||||||||||||||||||| | || |||||||||||||||||||||| |||||| |||| |
|
|
| T |
13083 |
tcttgcggcagacctcatctttacattgcttccaccgccatgccaggagctgactcactt |
13024 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University