View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8363_low_6 (Length: 366)
Name: NF8363_low_6
Description: NF8363
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8363_low_6 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 300; Significance: 1e-168; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 300; E-Value: 1e-168
Query Start/End: Original strand, 20 - 356
Target Start/End: Complemental strand, 42790544 - 42790208
Alignment:
| Q |
20 |
accagcaaccatgaagtacatgattaagcaaaagcagtactcaaaactcaaacattatcttggaattaaaatctaaaccaaaatgagcagaagattaaac |
119 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
42790544 |
accagcaaccatgaagtacatgattaagcaaaagcagtactcaaaactcaaacattatcttggaattaaaatctaaaccaaaatgagcagaagattaaac |
42790445 |
T |
|
| Q |
120 |
ttttgcaaatccatatcttatgtggtccattagtggtctgactgctgctccccactgtgtcattgtgggagatcacattttcactgcttatccttccttt |
219 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
42790444 |
atttgcaaatccatatcttatgtggtccattagtggtctgactgctgctccccactgtgtcattgtgggagatcacattttcactgcttatccttccttt |
42790345 |
T |
|
| Q |
220 |
cccatatttcataaatgaaacttttgaccccttggccctgcccacctaaagtgccacattcatctttgcatatatgactttactcctcaccnnnnnnngg |
319 |
Q |
| |
|
|||| ||||||| ||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| || |
|
|
| T |
42790344 |
cccacatttcatcaatgaaacttttgactccttggccctgcccacctaaagtgccacattcatctttgcatatatgactttactcctcacctttttttgg |
42790245 |
T |
|
| Q |
320 |
tgggagctctaagctcttcctccctcccctctctctg |
356 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||| |
|
|
| T |
42790244 |
tgggagctctaagctcttcctccctcccctctctctg |
42790208 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University