View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8364_high_18 (Length: 255)
Name: NF8364_high_18
Description: NF8364
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8364_high_18 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 71; Significance: 3e-32; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 71; E-Value: 3e-32
Query Start/End: Original strand, 73 - 143
Target Start/End: Complemental strand, 15346240 - 15346170
Alignment:
| Q |
73 |
aatgggctagctcttaacctagtgggtcagccaaggtcgaccatgttaaatacatgcgcagtaggttaggc |
143 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
15346240 |
aatgggctagctcttaacctagtgggtcagccaaggtcgaccatgttaaatacatgcgcagtaggttaggc |
15346170 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 58; E-Value: 2e-24
Query Start/End: Original strand, 179 - 240
Target Start/End: Complemental strand, 15346045 - 15345984
Alignment:
| Q |
179 |
taccgtttttaatgacatttatcaatgcaaaaattatgtggcaaacaaatagcttaattgta |
240 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||| |
|
|
| T |
15346045 |
taccgtttttaatgacatttatcaatgcaaaaattaggtggcaaacaaatagcttaattgta |
15345984 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University