View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8364_high_6 (Length: 380)
Name: NF8364_high_6
Description: NF8364
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8364_high_6 |
 | |
|
Alignment Details
Target: chr6 (Bit Score: 49; Significance: 6e-19; HSPs: 2)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 49; E-Value: 6e-19
Query Start/End: Original strand, 117 - 318
Target Start/End: Original strand, 34932262 - 34932463
Alignment:
| Q |
117 |
gtcttgcttttatcaaacagcaggacatctaaaacagataaaggaaagaatagagcgtgt-------ctactcatcaactgagtggtcacatttcggatg |
209 |
Q |
| |
|
|||||||||||||||| ||| |||||||| |||||||||||||||||||||||| |||| ||||||||||| ||||| ||||||| |||| | |
|
|
| T |
34932262 |
gtcttgcttttatcaagcagtgggacatcttaaacagataaaggaaagaatagagtgtgtgtacacaatactcatcaacagagtgatcacattccggacg |
34932361 |
T |
|
| Q |
210 |
tcctttcaattcaagccttcgccgctttctttccctgctgccttgtaactttagttctcttggctgtcttctttcgaacagcagttgtcttggctgtctg |
309 |
Q |
| |
|
||||| |||||||| || | || ||||||||| ||||| |||||||| | ||| ||||||||||| ||| |||||||| ||||||||||| |
|
|
| T |
34932362 |
tccttgaaattcaagtctccaccactttctttc-------ccttggaactttagcctttttgcctgtcttcttttgaagagcagttgccttggctgtctc |
34932454 |
T |
|
| Q |
310 |
ctttcgaac |
318 |
Q |
| |
|
|||| |||| |
|
|
| T |
34932455 |
ctttggaac |
34932463 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #2
Raw Score: 43; E-Value: 0.000000000000002
Query Start/End: Original strand, 303 - 365
Target Start/End: Original strand, 34932418 - 34932480
Alignment:
| Q |
303 |
ctgtctgctttcgaacagcaattgtcttggctgtctcctttggaactttagcatcagctttct |
365 |
Q |
| |
|
|||||| |||| ||| |||| ||| |||||||||||||||||||||||||||||||||||||| |
|
|
| T |
34932418 |
ctgtcttcttttgaagagcagttgccttggctgtctcctttggaactttagcatcagctttct |
34932480 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University