View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8364_low_15 (Length: 294)
Name: NF8364_low_15
Description: NF8364
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8364_low_15 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 240; Significance: 1e-133; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 240; E-Value: 1e-133
Query Start/End: Original strand, 22 - 273
Target Start/End: Original strand, 25117908 - 25118159
Alignment:
| Q |
22 |
agaagcagcaaacataataaagcaagcaataaccctagcaaagcgtcgtggccatgctcaagtaacaccacttcatgttgcaaacactatgcttagtgtt |
121 |
Q |
| |
|
|||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| || |||||||||||| |
|
|
| T |
25117908 |
agaagctgcaaacataataaagcaagcaataaccctagcaaagcgtcgtggccatgctcaagtaacaccacttcatgttgcaaatacgatgcttagtgtt |
25118007 |
T |
 |
| Q |
122 |
accaatggattattaagaacagcttgtcttcaatctcactctcaccctcttcaatgcaaggctttagagctttgcttcaatgtcgcactcaatcgtttgc |
221 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
25118008 |
accaatggattattaagaacagcttgtcttcaatctcactctcaccctcttcaatgcaaggctttagagctttgcttcaatgtcgcactcaatcgtttgc |
25118107 |
T |
 |
| Q |
222 |
cagcgacgacttgtaatagccctatgttgggttctcatcattctcaatctca |
273 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
25118108 |
cagcgacgacttgtaatagccctatgttgggttctcatcattctcaatctca |
25118159 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 54; E-Value: 5e-22
Query Start/End: Original strand, 134 - 219
Target Start/End: Complemental strand, 40588860 - 40588775
Alignment:
| Q |
134 |
ttaagaacagcttgtcttcaatctcactctcaccctcttcaatgcaaggctttagagctttgcttcaatgtcgcactcaatcgttt |
219 |
Q |
| |
|
||||||| |||||||||||||| |||||||||||||||||||||||| ||| | |||||||| |||||||| |||||||| ||||| |
|
|
| T |
40588860 |
ttaagaaaagcttgtcttcaatgtcactctcaccctcttcaatgcaaagctcttgagctttgtttcaatgttgcactcaaccgttt |
40588775 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University