View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8364_low_23 (Length: 253)
Name: NF8364_low_23
Description: NF8364
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8364_low_23 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 235; Significance: 1e-130; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 235; E-Value: 1e-130
Query Start/End: Original strand, 1 - 239
Target Start/End: Original strand, 45595630 - 45595868
Alignment:
| Q |
1 |
tttctaaccttgctcattaaaaagggatagcgtgatcgcaattcagtcatatgggattcacccccatatatctcccctgcagcaatatatattggagtct |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
45595630 |
tttctaaccttgctcattaaaaagggatagcgtgatcgcaattcagtcatatgggattcacccccatatatctcccctgcagcaatatatattggagtct |
45595729 |
T |
 |
| Q |
101 |
ttgcagggtatccaagagcactaaggaaaattccaacttcctttggagttaagggacaataccctttggccctctcttcttttggattgatgtgctttct |
200 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||| |
|
|
| T |
45595730 |
ttgcagggtatccaagagcactaaggaaaattccaacttcctttggagttaagggacaataccctttggccctctcttcttttggatcgatgtgctttct |
45595829 |
T |
 |
| Q |
201 |
tttccaataagtagtattctctctgtaagtttggttcat |
239 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
45595830 |
tttccaataagtagtattctctctgtaagtttggttcat |
45595868 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5 (Bit Score: 86; Significance: 3e-41; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 86; E-Value: 3e-41
Query Start/End: Original strand, 7 - 180
Target Start/End: Original strand, 27151335 - 27151508
Alignment:
| Q |
7 |
accttgctcattaaaaagggatagcgtgatcgcaattcagtcatatgggattcacccccatatatctcccctgcagcaatatatattggagtctttgcag |
106 |
Q |
| |
|
|||||||||||||| || ||||| || ||||||| ||||| ||||||||| ||||||||||| ||||| || |||||||||||||| || ||||||| | |
|
|
| T |
27151335 |
accttgctcattaacaatggataacgggatcgcagttcagccatatgggactcacccccataaatctctccagcagcaatatatatcggcgtctttgatg |
27151434 |
T |
 |
| Q |
107 |
ggtatccaagagcactaaggaaaattccaacttcctttggagttaagggacaataccctttggccctctcttct |
180 |
Q |
| |
|
| |||||||||||| |||| |||||||||||||||||||| |||||||| ||| ||||||||| ||||| |||| |
|
|
| T |
27151435 |
gatatccaagagcagtaagaaaaattccaacttcctttggtgttaaggggcaaaaccctttggacctctgttct |
27151508 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University