View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8364_low_24 (Length: 243)
Name: NF8364_low_24
Description: NF8364
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8364_low_24 |
 |  |
|
| [»] scaffold0122 (1 HSPs) |
 |  |  |
|
Alignment Details
Target: chr8 (Bit Score: 199; Significance: 1e-108; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 199; E-Value: 1e-108
Query Start/End: Original strand, 20 - 237
Target Start/End: Original strand, 25104470 - 25104685
Alignment:
| Q |
20 |
atagcgatgctgataggatcaaagaataaaatactggataacaacttgctttgtgccaccgacactgctaatagaaggtgtaacactgtgtcttacacgt |
119 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||| |
|
|
| T |
25104470 |
atagcgatgctgataggatcaaagaataaaatactggataacaacttgctttgtgccaccgacacttctaatagaaggtgtaacactgtgtcttacacgt |
25104569 |
T |
 |
| Q |
120 |
gcctggacacacactgacacgacatcgacacatgtgattacatttacattgaattgtcattttgtcaaaattttatcggtgtcaacgtgtctggtgtccg |
219 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||| |
|
|
| T |
25104570 |
gcctggacacacactgacacgacatcgacacatgtgattacatttacattgaattgtcattttgtcaaaattttatcggtgtcaa--tgtctggtgtccg |
25104667 |
T |
 |
| Q |
220 |
tgtatgtgtctctgcttc |
237 |
Q |
| |
|
||||||||||| |||||| |
|
|
| T |
25104668 |
tgtatgtgtctgtgcttc |
25104685 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2 (Bit Score: 36; Significance: 0.00000000002; HSPs: 3)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 133 - 227
Target Start/End: Complemental strand, 30538391 - 30538304
Alignment:
| Q |
133 |
ctgacacgacatcgacacatgtgattacatttacattgaattgtcattttgtcaaaattttatcggtgtcaacgtgtctggtgtccgtgtatgtg |
227 |
Q |
| |
|
|||||||||||| |||||||||||||||||| | ||||||||||| |||||||| |||| |||||||| ||| |||||||||||| |||| |
|
|
| T |
30538391 |
ctgacacgacattgacacatgtgattacattaa------attgtcattttttcaaaattgtatctgtgtcaacttgt-tggtgtccgtgtctgtg |
30538304 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 176 - 217
Target Start/End: Original strand, 6117721 - 6117762
Alignment:
| Q |
176 |
tcattttgtcaaaattttatcggtgtcaacgtgtctggtgtc |
217 |
Q |
| |
|
||||||| ||||||| ||||||||||||||||||| |||||| |
|
|
| T |
6117721 |
tcattttatcaaaatattatcggtgtcaacgtgtcaggtgtc |
6117762 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #3
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 163 - 212
Target Start/End: Original strand, 32104079 - 32104128
Alignment:
| Q |
163 |
ttacattgaattgtcattttgtcaaaattttatcggtgtcaacgtgtctg |
212 |
Q |
| |
|
|||||||||||||||||||| ||||| | ||| || |||||||||||||| |
|
|
| T |
32104079 |
ttacattgaattgtcattttttcaaattattagcgctgtcaacgtgtctg |
32104128 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6 (Bit Score: 34; Significance: 0.0000000003; HSPs: 2)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 163 - 209
Target Start/End: Complemental strand, 10031611 - 10031563
Alignment:
| Q |
163 |
ttacattgaatt--gtcattttgtcaaaattttatcggtgtcaacgtgt |
209 |
Q |
| |
|
|||||||||||| |||||||| |||||||||||||||||||||||||| |
|
|
| T |
10031611 |
ttacattgaattatgtcattttctcaaaattttatcggtgtcaacgtgt |
10031563 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #2
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 163 - 210
Target Start/End: Complemental strand, 19369858 - 19369809
Alignment:
| Q |
163 |
ttacattgaatt--gtcattttgtcaaaattttatcggtgtcaacgtgtc |
210 |
Q |
| |
|
|||||||||||| |||||||| ||||||||||||| ||||||||||||| |
|
|
| T |
19369858 |
ttacattgaattatgtcattttctcaaaattttatccgtgtcaacgtgtc |
19369809 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5 (Bit Score: 31; Significance: 0.00000002; HSPs: 5)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 174 - 212
Target Start/End: Complemental strand, 309186 - 309148
Alignment:
| Q |
174 |
tgtcattttgtcaaaattttatcggtgtcaacgtgtctg |
212 |
Q |
| |
|
||||||||| ||||||||||||||||||| ||||||||| |
|
|
| T |
309186 |
tgtcattttctcaaaattttatcggtgtcgacgtgtctg |
309148 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 163 - 212
Target Start/End: Complemental strand, 15302564 - 15302515
Alignment:
| Q |
163 |
ttacattgaattgtcattttgtcaaaattttatcggtgtcaacgtgtctg |
212 |
Q |
| |
|
|||| ||||||||||||||| |||||||||||||| |||| | ||||||| |
|
|
| T |
15302564 |
ttaccttgaattgtcattttttcaaaattttatcgttgtcgatgtgtctg |
15302515 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #3
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 179 - 212
Target Start/End: Original strand, 19167613 - 19167646
Alignment:
| Q |
179 |
ttttgtcaaaattttatcggtgtcaacgtgtctg |
212 |
Q |
| |
|
|||| ||||||||||||||||||||||||||||| |
|
|
| T |
19167613 |
ttttttcaaaattttatcggtgtcaacgtgtctg |
19167646 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #4
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 130 - 163
Target Start/End: Original strand, 32979596 - 32979629
Alignment:
| Q |
130 |
acactgacacgacatcgacacatgtgattacatt |
163 |
Q |
| |
|
|||||||||||||||| ||||||||||||||||| |
|
|
| T |
32979596 |
acactgacacgacatcaacacatgtgattacatt |
32979629 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #5
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 174 - 222
Target Start/End: Original strand, 9031956 - 9032004
Alignment:
| Q |
174 |
tgtcattttgtcaaaattttatcggtgtcaacgtgtctggtgtccgtgt |
222 |
Q |
| |
|
|||||||| |||||| ||||||||||||| ||| |||||||||||||| |
|
|
| T |
9031956 |
tgtcatttcctcaaaaatttatcggtgtcaccgtatctggtgtccgtgt |
9032004 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0122 (Bit Score: 29; Significance: 0.0000003; HSPs: 1)
Name: scaffold0122
Description:
Target: scaffold0122; HSP #1
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 174 - 210
Target Start/End: Original strand, 10328 - 10364
Alignment:
| Q |
174 |
tgtcattttgtcaaaattttatcggtgtcaacgtgtc |
210 |
Q |
| |
|
||||||||||||||||||||||| ||||||| ||||| |
|
|
| T |
10328 |
tgtcattttgtcaaaattttatctgtgtcaatgtgtc |
10364 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University