View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8364_low_6 (Length: 410)
Name: NF8364_low_6
Description: NF8364
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8364_low_6 |
 | |
|
| [»] chr7 (1 HSPs) |
| |
|
Alignment Details
Target: chr7 (Bit Score: 406; Significance: 0; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 406; E-Value: 0
Query Start/End: Original strand, 1 - 410
Target Start/End: Complemental strand, 41277031 - 41276622
Alignment:
| Q |
1 |
ttgagagtaaggtaggacgctgtttatgtcttatgaaattgtttttgttgtcttgtgttttttctactgcattttgcgggattgggttatcctagaatta |
100 |
Q |
| |
|
||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
41277031 |
ttgagagtaaggtaggatgctgtttatgtcttatgaaattgtttttgttgtcttgtgttttttctactgcattttgcgggattgggttatcctagaatta |
41276932 |
T |
|
| Q |
101 |
ataggaggcgatgttttcattagtttttgttaagaaaatttgtcaattatgttcttaggatggtagttggcgcaagaaagaagagggatggatgaagaga |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
41276931 |
ataggaggcgatgttttcattagtttttgttaagaaaatttgtcaattatgttcttaggatggtagttggcgcaagaaagaagagggatggatgaagaga |
41276832 |
T |
|
| Q |
201 |
gaagctgcattgctttttgatgtccagaaccttaagaaggtatactttttatattactatgatgttaatgatggatgcatacctgccgtttagattggaa |
300 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
41276831 |
gaagctgcattgctttttgatgtccagaaccttaagaaggtatactttttatattactatgatgttaatgatggatgcatacctgccgtttagattggaa |
41276732 |
T |
|
| Q |
301 |
aaagtcttgttttaaaaatttagaaccattttctgtagtagacccacttctgatactgttagtatttctatatggaatatctggcagagctttgctccag |
400 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
41276731 |
aaagtcttgttttaaaaatttagaaccattttctgtagtagacccacttctgatactgttagtatttctatatggaatatctggcagagctttgctccag |
41276632 |
T |
|
| Q |
401 |
ttccatacct |
410 |
Q |
| |
|
|||||||||| |
|
|
| T |
41276631 |
ttccatacct |
41276622 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University