View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF8365_low_3 (Length: 267)

Name: NF8365_low_3
Description: NF8365
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF8365_low_3
NF8365_low_3
[»] chr3 (2 HSPs)
chr3 (100-267)||(48955873-48956036)
chr3 (3-44)||(48956092-48956133)


Alignment Details
Target: chr3 (Bit Score: 139; Significance: 8e-73; HSPs: 2)
Name: chr3
Description:

Target: chr3; HSP #1
Raw Score: 139; E-Value: 8e-73
Query Start/End: Original strand, 100 - 267
Target Start/End: Complemental strand, 48956036 - 48955873
Alignment:
100 ggaagcaaaccctaatatgtccgtatagatccacatttttgtttttcttccattaattaatggacacattcctacctttaccttttccttcagatctgat 199  Q
    |||| ||||||||||||||||||||||||||||||||||||||||||||||||||||    |||||||||||||||||||||||||||||||||| ||||    
48956036 ggaaccaaaccctaatatgtccgtatagatccacatttttgtttttcttccattaat----ggacacattcctacctttaccttttccttcagatttgat 48955941  T
200 tcaatccttaattatgtctccttttggttattttcttcactccacatagtttccagttttggctttct 267  Q
    ||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||    
48955940 tcaatccttaattgtgtctccttttggttattttcttcactccacatagtttccagttttggctttct 48955873  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #2
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 3 - 44
Target Start/End: Complemental strand, 48956133 - 48956092
Alignment:
3 agagagtaggcttttgttgaatttggacctggacttgtgtga 44  Q
    ||||||||||||||||||||||||||||||| ||||||||||    
48956133 agagagtaggcttttgttgaatttggacctgcacttgtgtga 48956092  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University