View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8365_low_3 (Length: 267)
Name: NF8365_low_3
Description: NF8365
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8365_low_3 |
 |  |
|
| [»] chr3 (2 HSPs) |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 139; Significance: 8e-73; HSPs: 2)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 139; E-Value: 8e-73
Query Start/End: Original strand, 100 - 267
Target Start/End: Complemental strand, 48956036 - 48955873
Alignment:
| Q |
100 |
ggaagcaaaccctaatatgtccgtatagatccacatttttgtttttcttccattaattaatggacacattcctacctttaccttttccttcagatctgat |
199 |
Q |
| |
|
|||| |||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
48956036 |
ggaaccaaaccctaatatgtccgtatagatccacatttttgtttttcttccattaat----ggacacattcctacctttaccttttccttcagatttgat |
48955941 |
T |
 |
| Q |
200 |
tcaatccttaattatgtctccttttggttattttcttcactccacatagtttccagttttggctttct |
267 |
Q |
| |
|
||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
48955940 |
tcaatccttaattgtgtctccttttggttattttcttcactccacatagtttccagttttggctttct |
48955873 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 3 - 44
Target Start/End: Complemental strand, 48956133 - 48956092
Alignment:
| Q |
3 |
agagagtaggcttttgttgaatttggacctggacttgtgtga |
44 |
Q |
| |
|
||||||||||||||||||||||||||||||| |||||||||| |
|
|
| T |
48956133 |
agagagtaggcttttgttgaatttggacctgcacttgtgtga |
48956092 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University