View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8365_low_4 (Length: 251)
Name: NF8365_low_4
Description: NF8365
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8365_low_4 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 194; Significance: 1e-105; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 194; E-Value: 1e-105
Query Start/End: Original strand, 1 - 210
Target Start/End: Original strand, 53682818 - 53683026
Alignment:
| Q |
1 |
tttgagttcattgctttcagtttcttcactgctatctgtaatttccaatgaaaagagagttaatggcaaagacaaggactttgtcacttcatattaaaga |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
53682818 |
tttgagttcattgctttcagtttcttcactgctatctgtaatttccaatgaaaagagagttaatggcaaagacaaggactttgtcacttcatattaaaga |
53682917 |
T |
|
| Q |
101 |
catgttccgtgtccgatatgtgttcagtggttacattcaccgattccattttctaaaattactatcgatgtcaatgtcgtgtctacatcaccaaattaat |
200 |
Q |
| |
|
|||||||||||||||||||||| ||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
53682918 |
catgttccgtgtccgatatgtg-tcagtggttacgttcaccgattccattttctaaaattactatcgatgtcaatgtcgtgtctacatcaccaaattaat |
53683016 |
T |
|
| Q |
201 |
gtcctaatga |
210 |
Q |
| |
|
|| ||||||| |
|
|
| T |
53683017 |
gttctaatga |
53683026 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University