View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8366_high_8 (Length: 238)
Name: NF8366_high_8
Description: NF8366
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8366_high_8 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 170; Significance: 2e-91; HSPs: 2)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 170; E-Value: 2e-91
Query Start/End: Original strand, 46 - 223
Target Start/End: Complemental strand, 16525654 - 16525477
Alignment:
| Q |
46 |
ctccattccagcttaaatctgcttcaaatcctgctgcattcacttttctatttggaaatgatccgttaggacatgagatcttacgtctgcgagaagtaat |
145 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||| || |
|
|
| T |
16525654 |
ctccattccagcttaaatctgcttcaaatcctgctgcattcacttttctatttggaaatgatccgttaggacatgagatcttatgtctgcgagaagtgat |
16525555 |
T |
 |
| Q |
146 |
aactttgagccgccgacctcgttcagtagtatccttcttctccaagagggatggggagtggtagtcgtggggatgtat |
223 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
16525554 |
aactttgagccgccgacctcgttcagtagtatccttcttctccaagagggatggggagtggtagtcgtggggatgtat |
16525477 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 50; E-Value: 9e-20
Query Start/End: Original strand, 1 - 50
Target Start/End: Complemental strand, 16525760 - 16525711
Alignment:
| Q |
1 |
tctgtctcgtacgatgatagagctgcaccagtttgctttcttgacctcca |
50 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
16525760 |
tctgtctcgtacgatgatagagctgcaccagtttgctttcttgacctcca |
16525711 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University