View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF8366_high_8 (Length: 238)

Name: NF8366_high_8
Description: NF8366
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF8366_high_8
NF8366_high_8
[»] chr8 (2 HSPs)
chr8 (46-223)||(16525477-16525654)
chr8 (1-50)||(16525711-16525760)


Alignment Details
Target: chr8 (Bit Score: 170; Significance: 2e-91; HSPs: 2)
Name: chr8
Description:

Target: chr8; HSP #1
Raw Score: 170; E-Value: 2e-91
Query Start/End: Original strand, 46 - 223
Target Start/End: Complemental strand, 16525654 - 16525477
Alignment:
46 ctccattccagcttaaatctgcttcaaatcctgctgcattcacttttctatttggaaatgatccgttaggacatgagatcttacgtctgcgagaagtaat 145  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||| ||    
16525654 ctccattccagcttaaatctgcttcaaatcctgctgcattcacttttctatttggaaatgatccgttaggacatgagatcttatgtctgcgagaagtgat 16525555  T
146 aactttgagccgccgacctcgttcagtagtatccttcttctccaagagggatggggagtggtagtcgtggggatgtat 223  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
16525554 aactttgagccgccgacctcgttcagtagtatccttcttctccaagagggatggggagtggtagtcgtggggatgtat 16525477  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #2
Raw Score: 50; E-Value: 9e-20
Query Start/End: Original strand, 1 - 50
Target Start/End: Complemental strand, 16525760 - 16525711
Alignment:
1 tctgtctcgtacgatgatagagctgcaccagtttgctttcttgacctcca 50  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||    
16525760 tctgtctcgtacgatgatagagctgcaccagtttgctttcttgacctcca 16525711  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University