View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8366_low_6 (Length: 363)
Name: NF8366_low_6
Description: NF8366
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8366_low_6 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 268; Significance: 1e-149; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 268; E-Value: 1e-149
Query Start/End: Original strand, 69 - 344
Target Start/End: Original strand, 53682490 - 53682765
Alignment:
| Q |
69 |
caattggacacatatttgaggacgaaagattataatttttaacatgatttaatttaacgtttaatgatcgaaaataaaaaatggatgggtgaaagcttac |
168 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||| ||||||||||||||||||||||||| |
|
|
| T |
53682490 |
caattggacacatatttgaggacgaaagattataatttttaacatgatttaatttatcgtttaatgatcgaaaaaaaaaaatggatgggtgaaagcttac |
53682589 |
T |
|
| Q |
169 |
aaaatgccttcagcagagccaattgcaatgctcattctcttttgccagttgagttgcacttcaccagcatattgaccatggagatgagaaagcagactta |
268 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
53682590 |
aaaatgccttcagcagagccaattgcaatgctcattctcttttgccagttgagttgcacttcaccagcatattgaccatggagatgagaaagcagactta |
53682689 |
T |
|
| Q |
269 |
gatttggcatgtaatcatagacaataagcctttgatcatcgccaacacaatagccccttagacctaacaaattttt |
344 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
53682690 |
gatttggcatgtaatcatagacaataagcctttgatcatcgccaacacaatagccccttagacctaacaaattttt |
53682765 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 51; E-Value: 4e-20
Query Start/End: Original strand, 19 - 73
Target Start/End: Original strand, 53682397 - 53682451
Alignment:
| Q |
19 |
gggtgtgacctcatggtgcaagtacctagcaacaaaatagtcaaatgtgacaatt |
73 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||| ||||||| |
|
|
| T |
53682397 |
gggtgtgacctcatggtgcaagtacctagcaacaaaatagtcaaatgcgacaatt |
53682451 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University