View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8367_high_5 (Length: 222)
Name: NF8367_high_5
Description: NF8367
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8367_high_5 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 102; Significance: 8e-51; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 102; E-Value: 8e-51
Query Start/End: Original strand, 105 - 206
Target Start/End: Original strand, 30223287 - 30223388
Alignment:
| Q |
105 |
taacctaaccacaacatctctcacttcagtagcttcatttcgctttcttctttcttcaccagatcatgctacgaaacctcgcttgcaacattgcttcatc |
204 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
30223287 |
taacctaaccacaacatctctcacttcagtagcttcatttcgctttcttctttcttcaccagatcatgctacgaaacctcgcttgcaacattgcttcatc |
30223386 |
T |
 |
| Q |
205 |
tc |
206 |
Q |
| |
|
|| |
|
|
| T |
30223387 |
tc |
30223388 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University