View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF8367_high_5 (Length: 222)

Name: NF8367_high_5
Description: NF8367
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF8367_high_5
NF8367_high_5
[»] chr1 (1 HSPs)
chr1 (105-206)||(30223287-30223388)


Alignment Details
Target: chr1 (Bit Score: 102; Significance: 8e-51; HSPs: 1)
Name: chr1
Description:

Target: chr1; HSP #1
Raw Score: 102; E-Value: 8e-51
Query Start/End: Original strand, 105 - 206
Target Start/End: Original strand, 30223287 - 30223388
Alignment:
105 taacctaaccacaacatctctcacttcagtagcttcatttcgctttcttctttcttcaccagatcatgctacgaaacctcgcttgcaacattgcttcatc 204  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
30223287 taacctaaccacaacatctctcacttcagtagcttcatttcgctttcttctttcttcaccagatcatgctacgaaacctcgcttgcaacattgcttcatc 30223386  T
205 tc 206  Q
    ||    
30223387 tc 30223388  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University