View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8367_low_1 (Length: 443)
Name: NF8367_low_1
Description: NF8367
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8367_low_1 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 138; Significance: 6e-72; HSPs: 2)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 138; E-Value: 6e-72
Query Start/End: Original strand, 1 - 157
Target Start/End: Original strand, 32626168 - 32626325
Alignment:
| Q |
1 |
tgtaaacccttttggatggattgccaaagcagaaa-gtatcatataaatatgttttactttgtttcatatttattatataatgtagatctttttcttagt |
99 |
Q |
| |
|
|||||||||| |||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32626168 |
tgtaaaccctcttggatggattgccaaagcagaaaagtatcatataaatatgttttactttgtttcatatttattatataatgtagatctttttcttagg |
32626267 |
T |
 |
| Q |
100 |
cgtgaactttatctttgaatcacaacaagataaggtgattgatgttgatgagtaaaag |
157 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||| |||||| |
|
|
| T |
32626268 |
cgtgaactttatctttgaatcacaacaagataaggtgattgatgttgatgaataaaag |
32626325 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 135; E-Value: 3e-70
Query Start/End: Original strand, 269 - 443
Target Start/End: Original strand, 32626398 - 32626572
Alignment:
| Q |
269 |
acaaaaatccgtgtgtatccatgagacacaaaatgatatgtttaaaatgaatatttaatttcaactggattcaaacatttaatctgaagacgattttcaa |
368 |
Q |
| |
|
||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||| |||||| || |
|
|
| T |
32626398 |
acaaaaatccgtgtgtatccatgtgacacaaaatgatatgtttaaaatgaatatttaatctcaactggattcaaacatttaatctgaagatgatttttaa |
32626497 |
T |
 |
| Q |
369 |
attgtcataaattgtatactaagacaaaatgtctttaagttagttcaaaatcggcttaatagggatttaaaaact |
443 |
Q |
| |
|
||||||||||| |||||||||||||||| |||||||||||||||||||| || ||||| ||||||||||||||| |
|
|
| T |
32626498 |
attgtcataaaccgtatactaagacaaaacgtctttaagttagttcaaaaccgacttaaaagggatttaaaaact |
32626572 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University