View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8367_low_7 (Length: 213)
Name: NF8367_low_7
Description: NF8367
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8367_low_7 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 91; Significance: 3e-44; HSPs: 3)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 91; E-Value: 3e-44
Query Start/End: Original strand, 77 - 199
Target Start/End: Original strand, 34596147 - 34596268
Alignment:
| Q |
77 |
tgaaaagatatttgttactgctgtttagtctgttgctatatgttaggaattatgctattgctgtctttatttgtcctagtctttaggaagcagtttcaca |
176 |
Q |
| |
|
||||||||||||||||||||| ||| |||||||| ||||||||||||||||||| ||||| ||||||||||||||||||||||||||||| ||||||||| |
|
|
| T |
34596147 |
tgaaaagatatttgttactgccgtt-agtctgtttctatatgttaggaattatgttattgttgtctttatttgtcctagtctttaggaagtagtttcaca |
34596245 |
T |
|
| Q |
177 |
tttcattcagtcgtgtgagtatt |
199 |
Q |
| |
|
|||||||||||||| |||||||| |
|
|
| T |
34596246 |
tttcattcagtcgtttgagtatt |
34596268 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 91; E-Value: 3e-44
Query Start/End: Original strand, 77 - 199
Target Start/End: Original strand, 34600424 - 34600545
Alignment:
| Q |
77 |
tgaaaagatatttgttactgctgtttagtctgttgctatatgttaggaattatgctattgctgtctttatttgtcctagtctttaggaagcagtttcaca |
176 |
Q |
| |
|
||||||||||||||||||||| ||| |||||||| ||||||||||||||||||| ||||| ||||||||||||||||||||||||||||| ||||||||| |
|
|
| T |
34600424 |
tgaaaagatatttgttactgccgtt-agtctgtttctatatgttaggaattatgttattgttgtctttatttgtcctagtctttaggaagtagtttcaca |
34600522 |
T |
|
| Q |
177 |
tttcattcagtcgtgtgagtatt |
199 |
Q |
| |
|
|||||||||||||| |||||||| |
|
|
| T |
34600523 |
tttcattcagtcgtttgagtatt |
34600545 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #3
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 26 - 74
Target Start/End: Complemental strand, 33435910 - 33435862
Alignment:
| Q |
26 |
gactaaagaaagacaataactattagtctatgcccaacatggtgaaagg |
74 |
Q |
| |
|
|||||||||||| ||||||||||| |||||||||||| ||||||||| |
|
|
| T |
33435910 |
gactaaagaaagcaaataactattaacctatgcccaacaaggtgaaagg |
33435862 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7 (Bit Score: 37; Significance: 0.000000000005; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 37; E-Value: 0.000000000005
Query Start/End: Original strand, 26 - 74
Target Start/End: Complemental strand, 40348119 - 40348071
Alignment:
| Q |
26 |
gactaaagaaagacaataactattagtctatgcccaacatggtgaaagg |
74 |
Q |
| |
|
|||||||||||| ||||||||||||||||||| ||||||| |||||||| |
|
|
| T |
40348119 |
gactaaagaaagccaataactattagtctatgtccaacatagtgaaagg |
40348071 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1 (Bit Score: 37; Significance: 0.000000000005; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 37; E-Value: 0.000000000005
Query Start/End: Original strand, 108 - 172
Target Start/End: Complemental strand, 36479741 - 36479677
Alignment:
| Q |
108 |
gttgctatatgttaggaattatgctattgctgtctttatttgtcctagtctttaggaagcagttt |
172 |
Q |
| |
|
|||||||| ||||||||||||| ||||| ||| || |||||||||||||||||||||| ||||| |
|
|
| T |
36479741 |
gttgctatttgttaggaattataatattgttgttttcatttgtcctagtctttaggaagtagttt |
36479677 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6 (Bit Score: 30; Significance: 0.00000007; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 30; E-Value: 0.00000007
Query Start/End: Original strand, 29 - 74
Target Start/End: Original strand, 14215982 - 14216027
Alignment:
| Q |
29 |
taaagaaagacaataactattagtctatgcccaacatggtgaaagg |
74 |
Q |
| |
|
||||||||| ||||||||||||| |||| ||||||||||| ||||| |
|
|
| T |
14215982 |
taaagaaagccaataactattagcctattcccaacatggtaaaagg |
14216027 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University